Description :
From Genome Similarity Track
Location :
Scaffold_729:1309- 8069
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_729-snap-gene-0.4Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_729-snap-gene-0.5Whole genome shotgun sequence assembly, scaffold_11, strain Mel28

Sequence
6760 bases(100 bases per row)
TGCCGACGTTTTTTTTTCCGCCAGCAGCGCTGGATCGACGTCGCGTACGCGTTTTCCCACATGACGCGCAGGACTTGCTCCCGCTTCTGCGCCTCCAGAT
GGTCCTTCAGCTCATGGAACTTTGCACGCGCCAGTTTCGCGCGATACGCGGCTTGGAGCTTCTGGGTTGCGCTGGTTTTCTTCTGCATCAGCCGGTGCAC
GCGCTTGTCAAAGAAGATCAGGAACCGTGCGCGCTTGAAGAAATGCTGCATAACCAACGCCGCGGAGCTCATGATCTTTTTGCGAGCGCGTGCCCTTCGC
ATTCGCGTGACGCGCACGCGAAACCAGAGCTGGATCGCGATCGCGGCGTGGAACCGCGCAAGCCGATGCAGCCACACGCGCAGGAGCCTTTGCTTTGCGC
AGTAGCGACGGATCGCTCTCGTAATCATGCTCCCAGCTCGGTTTACTATCAGGAAATCACGAAACGCACGTCGAAAGAGGTGGCAACGGAAACAACGTTG
AACCACTTGGCTTGCCTGAGTGTACTGATGGTACCAATGCATTCTTCGCAGCATCTTGCGGCAGTGAAAGCCGCGCCACAGAGCCTGGAGCCGCGTGGCG
GCGTACTGCACTCGGTATCCCGCTCGCACGCGCTTTGCGATCATCACACGCGTGCAGCTTTGAATCGTCACGAGCGCTGCGAACCTTTCAATCTCACTTT
GCTCTGCAACGAGCGTGCGCCAGTTCTGCAATCGCTTCACTAGCATCAAGCGTAACTCGGTGCGAGCTCTCGTCATTATCCAAAGAGCAGATTTCCTAGA
TGTCAGAGACCCAGGCAAATAGATTTTGTGAACTTCGTGTGTACCCAGCATATAGTATGATGTTGCGAGTGGAAGTCAAGCGTACAGTTTGCAGAATTTG
CCGACGCGTTCTTGACAGTGGAGCCCGATCATTTGCTGGCGCCACCAATCGAACCTTCTTGACTTCATCCGCAGACTGGATCTCGCCAAAATACCCTACG
AAGAGAAATCAATGTACATTCAAAAACAAACTCTGATTAGGAGCAAAACTGTAGGTGGAGAGAGAGAGCGAAATTACATGACTGGACGAACCGATAGTTT
GCTGATAGCGAAATGCTTTCGGATTGTTACTGATGCGTGCGAGTCCAGCAATTCCTGGACGCAGTGCTCTCGCACCCAGTCACACGACCTTCGCACTGTA
CCCATGTAGACATGGATCAAAAATATCAGCAAGGCTTGCTGTTCGGCGATGGGCTGTTGACGTTGAAAGATAGCTCACTGATCGCATGAAGGAGGCACTC
ACCGAGTTGTCGATGCCGTTGCTCATGGAGACTTGATCGAAGTTGATTCGCTTCTTGAAGGCGAATACAAGTTTCATCCTGTCTATCTTGCTCAGTGCCA
CTCTGCCTGGTCTGGATAAACTTTTGGTCGTAGGGAAGCACTGTCGCTGCTAGGCGTCTTTTCGTCTTGGCTTTCGTTGGGGATCTTGTCGGAGCGGGGC
TTGGGATCAGGAGCACCGAGCTCGCAGATGACATTCGCTCGATCGCTGGCGACAGTGGCGCTAACCGCCCCTTTCTTGGACTGAGCGTACTGGAGGCAGT
CGCAATTGGTATCTGCTTTGAAGAGCCCTTCACTTTGAATGCAACACCATGATCCCAGACACTGTCGCAAAGCATCTTGTACGGGCTGAAGCCTGGTCTG
TTTGGCCCAAGATCTTGCGCTACTTTACGGGAGGCCTCGAGAGTCACTTCCAGTTCCATGAGCTGGTCGTAGTTGACGCCCACTTCTCGCAGCAAACCTG
CGCTCTCCAGTACGCACGCGACGTCGTCATGATTCACTACAAAGAGAATGTCCTGTGGCGACAGCCGACGTCTGCGAAATTTGTCCTCCCATAGCGCCAA
AGTGTGTTGATCATGCTCGCAGACGGCGGCTGCCTCTTGTACAGGAGTTGCAGGCGTCGTGACGACCTTGGCAGGCGATTTTAGTCTGCCTGACGAGACT
AGGGACGCTGCGGAGCGACGGTCAATCGCTTGGAGCTGGGAGGGCAGACTCAGTCCCTTCTTCTTCCTTGTGGTAATAGTCTCACGCGATACCGGTGATG
GCGGTGTTACCATCACAGCCCGAGTTGACTCGAATAATGAGTCAGTTCGAGTCTTCACGGGTGGAGTGACCAAGAGTTCGGCACGACGGTAATTGCTCTG
ATACGGGAATATCTCCTCCAGGATGTCATCGACAGTCTTCACGCTCCCACTGACCGCTTGCAGGCGCTCGACGTATGTCTGCTGTCGCTCAAGCGAGTGA
TTACGAGTGTCACGAGCGCTGCTGGTATTGGTTATGGTGGCTTTCATTTTGATCGTCTTCTCATCACTTCCATTCTTCTCAATAGCCAACTGTCGACTGA
GATGGCTCTGAGACTCGCACTAAGTCAGTCTTTGGGTGCTAGGATTGCTTCGTATTATTAGCAATAGCCACTCGTTCTCATGACCTACAACCTGGAGGTC
GACTCAGAATATCATCAATCTTCAATCCTCCTCCTCTTCACGCACGTGCAGCTCCTTCGCAGCCATGAATTCGAGCAGTTCCTTGCATTCGCCATCGCTC
AAGTAGGGCCGGAGTACTCTGATGCCATCTAAGTACAGCGCTTTGCTCCACGGACACTTCGCCAATCCTCGATAGAAAACGCGTCTTGCAGTGTCGATCT
TCCCCATCTGCACCTCAAAGCGGAGGTACAAACGCCAGCAGAGTGCATTGCCCTGCGTGCGCACGCTCTCAACCATGTCCTGGAAGATCCGGCGAACTCG
GTCGATGCCAGTCAGGTTTGATCCAAACTTGTGGAAGAGACAGCATGTCGATCTGTTTGGAGGCTGAGAAGTACTGAGAGTCGAGTCATTGACCTCATCA
ATCTGCCACGAGGCTTTGACAACAGACCGTTCAAGGCGACTGAACTCGCAGAGAAGCGCAAATAACCACTCGACGGCCGTGGGCGAGTCAAAATGGCGCT
GCCATCGCGTTCGCACACTCTGGAAGTGGCACCGAAGGTTCTGCGACATTGTATTGCTGGTCTCGGCGTCGACGTACAGTCGCAGCAGCAACGGATCGTG
CGGAAAGCGTTCCACTGCGCTCCCAATCGCGTGCCGCCAGTCTCGAGGCGCGACGATCGGGAACGCGCAGTTGAGCTGGTGTTTTTGGACAAACTCCAGG
TACAAGAGTCGCAACCAGCGATTTTGATGACGACTCAGACTTTGTTGAGCGCTGGACAGTTCCCACTCTTGGATAAGCGACTGGTACTCGTTGCAGGACG
CTTGGAAGCCAGACGTGGCGTAGATCGCCAAGCAGAGGTTGTGCATGCAGTAGCCGACACTCCATAGCCAGTCGTTTTGCTTAGTGCTCGTACCTAGGTT
GCTAGTGCTGTCCCCGCCGCTGATGTTGTTGTTGCTTTGTTTGATGTGCTGCTGCGTTGCGATTTCCAGCTCCACTCGATATTTCTCGACCAGCGCAGTT
TTAACCTCTGCGTTATCAACCAGTTTCTCAAGGTGTTTCCTCAGTTTCACTGGCTGCTTGCGGAATTGTTTCTCCAGTTTGTCCAGTAACCCCCAGTCTT
GCTGCTGCGGGTCCTGCCAAATGCTCCACAGAACGTAGAGCGTCTTCAGCTTTCGTAGCTTTTCGTCACTTATGCTCTTCGATATCGAACCTCCAGCATT
CATCATCTCACCAATCCATGTTTCATTGCGAGCGCGTAGAAATATCAGTGCGTGGAAGCTGCGGCTCATCTTTGCATCGCTGGTTGAGTGCAGATCAAGT
GACTGGACCGTCTTGTCGCAAATTCGATTCACTTGGCGAGCGTTCCCAGCTTGTTGTTCCAGCTTGGCGTACGCAAACATCAGCACGTCGTCTGTACTTG
GTGCTCCATCTGCTTCCATCAGTTGCTGGCAAAGCTGACGTGCGAACTGAAGACCCATGTGGTCCTTGTCCTCTTCTCCATCGCTAATATGAGAGACGAT
CTGTGCTTCAAAATCGATCCACAGATACTTGACTAGCCGGCCACTCTCACGGTCGCACTCGTTGTGGACAATGTCCAGCAATCGAGCGAACACATTTCGG
ATAAACGCAACTTTGCTGGGGTCAATCAGCGCTGCTTTACTCACGCGCGCACCACCGAGAAGCTCACGTTGCAGCAAATCCCTCCTTTGCAAAGGGGAAA
GCAGGATCGACTCGGATGACTCTAGGTCCATGGCTTTCAGGATCGGCGCGACTAGCTCTTCGTACTCATCAAAACTGTCGGCGTACAAGCCCTCGATCGC
TGTTGTCGATTGGTGAGCCGTGTCGCTCAACCACTGCACACCAACAAGCTTGAGCAAGTTGAGCACCATCGTCAGGCGGAATGTCCTGGGTACTCGAAAG
AGAAAAGGCTGGATCTCTTCCGTCAGCACCGCGCGGTCAGGTGCTTCGTCGATCAGCTCCAGGTGCAGCGGATCGGTCGATCGCAATGGGATCCACTGGG
TCGCGTCTTTCGTTTCCTCATGCTTGAGCCACTCCACAAATGCATCGTGGGCATCGACTACATCGTAACCTGCACGCTCATCGTGGAATTCCGCCATTGA
ATTTGCAATTTTCGCCTTCTGCTTCTCCTGTTTCTTGACTTGGGACTCCTGCTTCGCGATTGAGGACTCGGTACCGCGCAGTTCGCTCAGGATGCGCTCG
TACTCGCTGGTGTCGTCGATCTCGTCCAGTTTGATGCGGTATCCGTGGACGTTGCTGTACGTGAGGTTGTCACCCAGGAACTCGTCGTCATCGCTTCCAT
TCATTCGATTCTCTTCGTCATCTTCACCATTTGCGTCCATACTCCGGAAGCGTCTCTTTGTCCTTTGATTCGTGCCAGCGAGAGCCAAGAGGCTTTGCTG
GTGCTCTCGGCTTTGAACCGATTCCGAAGGGTTCATCGAACTGAGTTGAGTGGCTATGCGCTCGTGGATGAGTTTTGCGAACGCATTTGCCGACGGCAGG
TACGCATCTTTGAGGCTGACCTTGGTCATGCTAGCTGAGTCACTATGTTCATCACCACAGTGCGGCAAGTCCTGGTTCCACCTCGCTATGAAATCTCGCA
GCATGTCAGCGTGGTGCTGATCTGGCGTTCCTTCACCGTTTCCATGCGTTGTGGTCAAGTTGAGGTCGATCAGTGCTTGCAACTGGGCAATCGCTCGCTC
CGCATACCCTGCTTTTTGCTCCAGAACGCACATGCGCAAATGGAAGTCAAGCAGCAACTCCACGAGTCCCTGTGCTTTTTCGGAAGCTGCGACCACTTGA
TCAAACGAGACTGTAGGTGGCGATGCGAGGAGCGAGCCAGAGTCAAAGATCCGCACTGAAGATGACGAGGAACTTTGGGAGGTAGTACTTGACTGGGACT
TGAGCTTCTCTTGTTCCTTCGCCATCTCTTTAAATGCCTCTTTGCGTAGAATCGCGATGATCCGCGCGTATAGATCTCGCAGCAACGGCACGGAGAAGCT
CGCGAAATTCTGCTGACTTGTGCGCAACAAATGGCTCCAGAGGCTGCCATTTGTTGGATCCCGCTCAATCATCTCTTCCAATTGGCTCCGGAGTGTTTCG
TGGTCTCCTCTCACTGTATTTGTCGCTCCAGTGTTGCTGGTGGTGTTGCCACCAAAGTTCAGGTTCCGGATCGAGAGGTTCAGTTCCACGAGCCGAAGCT
CGCGGTTCCCTGGATTCGCTTCAATCGCCTTCTTGAGAATCGCAATCTGCTTCTCCACAACCATTGCTGATGTTTGATTTTTGCTACTAGCCTTGCGACG
CGTCAGTCGAAGCGACTGTTCCTGGAAGGCGATGAAATCGAGCCACGTTGCGATATCTCGAGGGTTTTTCTGCAGCAACTCATTGAAAATCTTGCTCCTC
GTCACGAGGTACTGCTCGACATTCGCTGTCTCCGTGCGCAGCAACTGCAGCTCTTCTTCCCTATCGTCATCCTTTTCCAAACTCTGGCTGATCACTGGAT
CGAGCGGGATATACGAAAGCTCTGCCGCAACTCCAGACCCAGAGCTGCTCTTGCTTTGCTGCTGCTGCTGTCGTGCAAGACGCTTCTCTGAATACGCCAT
ATACAACCGCCTCTGCCTCGAGTCCTTCTCCATCTGTCGCGCACTAACACCAAAATAGCGATGCTCCGATCCCGCTGCTTCTTTAGCTTTCTTCGCTTGA
TCTAAAGGTCCTGGACCGCCATAGTTCTTCTTCCTTTCCACGAGCCATTCGCCAGTGAACACGTTACGGCGCGTCGCCAGTGCGTAAACGGGCTTGTCCT
GCGCGTACAACGTGCCATAGAAGCGGTTTTCGCGGTCGCCCGCGCAGTCGAACTCAAACAGTTTGGTGCCGTTCGCGTCCTTGTCGTTCACTGTCGCCTG
CTTCATCCACATTTGAACTTCTTTTGGGGCAGTAGCCACCAGTTGGTTGTACTCGTATGTGTCCTGATCACTCGCGCGCAGTCGCTTGCGCTTGTGCTTA
TGCTTGCGGCTAGAGTCGTCATTATCGCTGTTGCTGTAATCGCTGTGTCTCCGTCTTAAAGACGACTCCTTCTTTTTCTTCGAGTCTTTTTTCTTCTTCA
AATGGCGCTCTTTGTAGCGAAAAAGCTGCTTTCCTTCATCGTCAAGATCACTTGTACTGGCGCTGTTGCTGTCGCTGTCGTTGTTCGAAAAATCTTGTCG
CGGTCGCTTGTGACTCTTTCGCCGTTTACCTGTTTTGCTACTGCTACTGTCGCTCTTGCC