Description :
From Genome Similarity Track
Location :
Scaffold_481:13087- 14852
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_481-abinit-gene-0.30Protein binding / zinc ion binding

Sequence
1765 bases(100 bases per row)
TCTTTGCTTCAGGATCCCCAAGCCATTTTGAAAGCGAAGATCCGCGAAATCCAGTCGAGTCCGCTGCTGACTCCGAAGGAGAAGGCGGAGTCGATGCAGA
ACCTCATGATGAAGAACTGGACCGAGTCGCGAGGCAAGGAAGCGGCTGCCAAGGCGCAGCCAGACAGTGACTCGGATCGTCGGCACAGGACGTTCCATGT
ATGAGTCCATGCGGTTGAATCGACTTGTAACCACCGACTGACTGATTCGATATCACTCTTATGCACAGAACGAGCAGGAAAACATCCTCGGATGCAGCCA
CTACCAGTGAGTACAAACTCGTCGCGTTTTGCAATTCGTCGACCGATCAGGAACTCACATTGAAATGCTGCATGGTTCAGGCGCAAATGCAAGCTCCAAG
GAAAATGCTGTGGCAAGTGGTACTCCTGTCGGTTTTGCCACGGTGCGTTGCAGCAATTGAGCCCACTCAGTTCGACGCAAGCAGTGTCTGACCCGACGTT
GCGTGTTGTTCCAGACGAGAACGAGTCTCATCCGTTCGACCGATACGCCACCGAGAATATCTCCTGCATGGAGTGCGAAACTGTCCAGGTACAGCACCAC
AATAGTGACTCGACGGAGCATCGCAGCAAACTTACAGTCGTATCGGTTGTTTCAGCCGGTTGGGAAGGTCTGCATCAACGAGAAGTGCAAGGTCGAGTTC
GCACGGTACTTCTGTGATGTGTGCAAGTTCTTCGACGACGATCCGTCCAAGGAGATTTACCACTGCGATAAATGCAAGATCTGCCGCATTGGAAAGGTGA
GCGAGTTGGGAGTGCACCGGCATCTTCGTCATTTAACGAACTTCGATCTCGCCTTGACTCGCCAGGGCCTCGACATCGATTATTTCCACTGCGACAAGTG
CAACGCGTGCATGAGCATCAGCCTCAAGAAGCACAAGTGTGTGGAGCGCTCGCTCGAGTCAAACTGCCCAATCTGCAGTCAGTTCATGTTCACGTCAACG
ACGCCGGTCATGTTTCTACCCTGCGGCCACTGCATGCACGTGTCGTGCTACGAAGAGTACACGCTGGTACGTGGTATGCTCACAACGCTGTGGATGTCGA
ACGAATCGTTTCATATATTCTTGTGCTCTGCAGACCAACTACATCTGCCCATTATGCTCCAAATCACTGGGAGATATGGAACACTACTTCGCCAGTATCG
ACGAGCTGCTGGAGCGAGAGCAAATGCCAGAGGAATACAAGGACATCAAGTCACTCATCTACTGCAGCGACTGCGAACGCAAGTCGACGACCAAGTTCCA
TTTCGTCTACCACAAGGTATGTCGTCGAACGATTCAGCTCACAGCAGCAAACGACAACAGGGAAACTAACTGCTCGAGTGTGAGTGCAGTGCCAACTCCC
AGACTGCGGATCGTACAACACGAAGCTGGTGCGCCAGTTCAGAGACCAGGGCGATCACACGAGTGCTTCAGCGGCAGGTTCCACCGCACCCAATTTGACC
CAGTAGGCGGAAGGAAACGAGCTAACAGTCGCCCCAGCATGACACCAGCATCCTTTGGTCATGGTCTGCACTGCAAAACTAATTTATCAAAATGATGAAA
GGCCATATCCCGCCTTAGATAATGGCGCTTCTATTGTGCTTCTCGCACTTGAATACGATGCAAAAGGAACTGTCTGTACGACCCAGTTCTTGAGGAATGC
CAAACAGAGATCAATCGGCTTCCTCTACACACATAGAGTCGTTGGGATCTGCTCTAGCGCTCGCG