Description :
From Genome Similarity Track
Location :
Scaffold_49:130835- 133519
Sequence
2684 bases(100 bases per row)
GTAACGCTTAAGACGTCCAACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGCAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAT
GGTCCGATGAAGCGGTGCTTCAGCTTATTGCTGCCGACAGAGCTGACAGTGTCAAGGGGTAGGCTCCTCGTGTCTAGTAACACTAAGTCCCCCACTTTAA
ATACACTTAAGTTTCCTCTTCCATGTTTGTCGGAGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAGTGCTCAGCTTGGTATCTATAC
AGGATTCCACTTGTTTCCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGT
GTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAGCCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAAC
TCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTCTGGCCGT
CTGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCCGTGAACCGCGGGTCTCGGTCCGA
GACAATCGTCTCCGGGAGACCGTGATAGCGAAACACGCCGTCAACGAACAACCTTGGGGTTTGTTCGCCCGTAACAGTAACGGGAACCGGAGCAAGATGT
ACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGCTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAAC
AGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGCGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTAACGTATTGGGCGACCCA
CTTGTACATGGGGGCCCACCAGAAGACCTGAGAGACCGACAGAAAGGTATTCTCGCGGCCCAAGTGGTCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGG
ATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGTTCATTGGGCTCCACCCGGTAATAGAGGAGGTCATCCTTCAACTCATATCGGT
GGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCTGCCATGAGGAACTTCACGATAGGCGCGACAGCCTCATCGTCCCGATA
CACCATGCGTATCCGATCATATAGATCCGTTGTCACCCGTGTGATGTGGGCCAACTCATAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGC
TTGCTCGGCTTGTACTCGACGCGGAAGCTGTACTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTTAGGCGAGTTAGTCGCCGTCCTCA
AGGACGCGTGGTCTGCGTAGATCACGAAGGGCCTCGGGCCCAGGAGGTGAACACGAAACTTCACTAGGGCATATTTCGTTTCCAGGAGCTCCTTGTCGTC
GACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAACGAGATGACTCGTTCATGTCCAGCCGTGTCGGCTTGCAGCAATGCACACCCGATG
GCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCATGGAGACTGGCCTTGATGCTGTCAAAAC
CATCCTGGTGCTCTTGGTCCTAGTGCCAGTCGACGTCCTTCTGAAAAAAGCCCGACAAGGGCTTAGCAAAGCCCGCGTACCCTGCGCTGTACTTATGAAG
GTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTTTGGGATCGGGGCGTCGGCCATACTGCTATGGCCTTGGCCTTGTCTGGGTCAGCCCGAACGCCC
ACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGTATTACGGCCAACA
CTCGACGGAGGTGTCCTAGATGCACCTCCATGGCTGTCTTGTCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGATGGGCGG
AACAGCTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTATTG
CGGTGAGCGGGATGTCACTCTCCCGCATTAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTTAACAA
CACATCCTTTCATGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTCCGAACG
CAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCG
AGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCATGCCGTACGCCTCGATCCGGTGGGAGTT