Description :
From Genome Similarity Track
Location :
Scaffold_766:13082- 15579
Transcript NameFunction/comments
g17300.t1hypothetical protein

Sequence
2497 bases(100 bases per row)
CTCGAGGTGCGTACGGAATGACGGACAGACGGACGGACGGACGGACGGACGGACGGACGGACGGACGGACGGACAGGTTACTCTGTTACTTGTAGGAGAC
TAGCCGAGCGCCGCCCGCGTTGCGGGCGGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTGTTTTTGCTATGACA
GGCTTATGTTTTATATCAGTATATTTTACAGTAGACTTGTATCAAAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTTCGCTTGTCTAGCATGCACT
GTTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCACACGCGTACTCGCTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCC
TAAGCCCGCTGCGGCTCGCAAGCTTCGCCTTCGCTTGTCTACCATGCACTGTTTGGTCCTGGGTTTTCACCCGCGTGCTTTGCACACGGACTTCAAACCA
CAGGCGTACTCGCTGCGCTCGTCTCACGTGGTTCACGTGTGTACGAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACT
GTTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCC
TAAGCCCGCTACGGCTCGCAAGCTTCGCCTTCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCG
CAGGCGTGCTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATTACCGCTATGCAAAGTGACAAATGTATTTCTTTCGTAAAATATGCATTCACACG
AAGTCGCTGCCTACGCTCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTTCCGCTCTGGATACTCGACCAACGCCTT
GAATCTCGATCTCGACGTAACCCTCGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGT
CCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGA
ACACGATGCGCGGGATCAACACATGCTGGCCTTGTCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGACGCGT
TCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATACCACTGATGTTC
AGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCG
CTATGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCTGTTGCGACTTCCGAATTGTTGATGTC
GGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGC
ATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACGCAGCCATTT
CTGCAGCACTATCGGAGGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGC
GTCGATTGTCTCTGTCGCCGAGCCACCCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCG
TTATCCAAAACGTCACGAAGCGTTCGGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTTGTCCCAAACTATCAAACTTGCTTTCCTCATCA
ATTCCGTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAAGGGGATTTTGAAGGTAGAATGCGCCGTCCGACCTCCCATAAG
CAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTCCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTA
CCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCGTTTAGGT
GGTCCTCCTCGCTAACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAG