Description :
From Genome Similarity Track
Location :
Scaffold_4:1308142- 1330256
Transcript NameFunction/comments
Phyin_T30-4PITG_03290Putative uncharacterized protein
Phyin_T30-4PITG_03291Phospholipid-transporting ATPase%2C putative
Phyin_T30-4PITG_03292GTPase
Phyin_T30-4PITG_03293Ser/thr protein kinase
Phyin_T30-4PITG_0329460S ribosomal protein L6
Phyin_T30-4PITG_03295Copper-transporting ATPase%2C putative
Phyin_T30-4PITG_03296Putative uncharacterized protein

Sequence
22114 bases(100 bases per row)
TCAGCAGAAGAAATTTGTAGTGATCCCATCGATGTCATCATCCAGTATTTCGCGGTATTTGAGATCTGCCACCTTCGTCTCCATTCTGCCAACCGAATAT
GGATGCGCTTGAGCCTTCATTGGTGTGTACGCTGAAGGTGTTCCTGGATACTGACAACCCCACATCTCACGATAGTTTTCCTTCAACTGATTGTTCAGCT
CCCAGTCAATTTTGTCTTCGGCAGGAAGAGCATCGTACAGTCCGAGATGCTTCAGCGATTCATCGTACCAGTCGCTCTTCTTTGTCGGTAACCTAATAAG
AGGAGAGAAGAAATCTTGAATATGACGTGCTGGTTTCTCTGGTTCACGACATCTCACACCGGTTTCCGGTGAGCCTGAGTTGCAAGGCAGATCATTATAC
GTCAGTCGCTTCAAGCCCGTCTTGCTGCTAGTGTCGGCTGGGTGAATGGCCACCGGTGAGAACACCGGCGAGTTGACCGAAGCTGCTTCACCGAGAAGAT
TTTGCCAGTAAGTCAACGGAGGAGAAACCAAGTGGGTTCCCAGAACTTCGAGCTTTGGACTCTTGAGGTCACACAAGCTGGCCACCATATCACCAAACAT
CGATTCGTCGTTGGCGTCGTCATTCCACTGCTCCACGGAGTCAGGTGCACCAAACAGGATCCTAGGGTCTGTGAAGATGTCATAGTTGAATCGGACATAC
TTTCGTAAGCCTTTGTCCATAGGCTCGGAGGACCGTACTGACGACGTCGCTATCAGGTTGCAGCTCACCAGGACGGATACCACGTCGTACACGCGGCGGT
GCACGTCCCGGTAAGGCGCCTCTACTGATGAACTTGGCAATAAGGTACCAATAAACTGCTTCGCTTCACCCAGGCGGGCACTTAAGGTGGGTAATCTCAC
CTCAGTTTGGTAGTCTTGTTGAAACAGCAGGCCCAGGAAGCAGACTGTCATATTCACTAAGCACGGCCACTTGCCTGCAGCTGCCTGGTCCTCGAACACT
CTGATGAGAGCACTGTCTTCTTCCACGAGGCTGATCCGCTTTGAGAGACGAGATTTTCGGAAATTCGTCATCACTTGAGCCGAGTTGCTCTTCATCTCCG
CCAGATGCTGCACCACCGTAGTCCTCCCGTAGTACAAGAAGTAGCCTCCGTTTGTCCTGCGCCTCTCGTCGTATCGAACACGCTTGATGACCTTAATTCC
TGCAGTCGCAAACACTCTCATTTCCGAGTTTCCCTTCACAAAAGCCAACAGAAATCATACCTTCCAGCACGTGCAGTACGTCGTAGATACGTCTCTTCCT
CGGCACTACGTAGCGATCATCAGGACAGACATCTCCAGGACGAAATGTACACGTCCTACCCTTCATCGTATAGATTTCGCTGGACGGGACGAAGATAGGG
AACACGGGCGAGGTGCCCTGCAAGTGCTCGTGCTCGGTGAGGAACTGCAACACAATTCGCGTTCTGGTGGGTGCCACCGTTCCACGTCAGCTGTATTGCC
CTCGTACGGGAACCTCTTGAAAACGTACATTTCCCCTAGACTCTTGGCAGCGGCGAATTGCTCTTGGATATTGCTCCACGTGGCTGCTGGGAGACCGTTC
TCGTGTCGTGTGGGCGCTGGACTGACACGACGAGGGCGTGGCTGGCGCTTTCGTCGCTTTATAGGCCGCTCGGGAGCACGCTCAATCTTGACGGGCACCT
CTGAGGCGGCGTCTTTGATGGGGGCGAAGCGTAGTTTGCGTCGGTGAGCGCGGTGAGTCTTCATCGGCCTGTGCTTGAGCCGGCAGATTCGAAAGTGAGG
CGGAAAGAAGGTATCCACAGTTGAAGTGGACCATCACTCTGCACCGTGTCGAGCTTGACAAGTTGAAGTGCGCCTTAGTGAAAAGGCAACTTTGGCAATT
TTGCGTCTCTTTACGAAAGTCGAGTGATGAAAAGTTTTTAGTAAAAGCAGACGCGTCTTTCTTGCATGTTGCAATCTTTCTTGAAAAGCACATGAGTATT
ATAAAGCACCTCAACAACTCAAGTTAAAAGAGAAGGAGGTAAAAATAGTGGGTTTCCGCAGCGCGAAACTCCTCCACCTGCATCTCACGATGCTCGTTCT
GATCTATTCAAAGTGGTGGACCGTTATTTTGCACCGAGCCACTAGGCGTTGCCGGTTCCCCAGGACTCAGCTCTCCCAATCTCTCGCTCTCATCCCTAGC
CTCTGATCGTGACTGTGCCATGGGCGAAGGAACGGCGGGACATGCCGGAGACTTCCGTGTGGTTCATCTAAACGATGCACACCGCAATACCGAGGCCGGC
TACTGCAACAACTTCATCATCACGTCCAAATACACGATAGCGAGTTTCCTGCCCAAGTTCCTTTTTGAAAGCTTTCGTAAACTTTCCAACCTCTACTTCT
TGATCATCTGCATCCTGCAGTGCATTCCGGATATCAGTAACACGAACGGAAGTCCTTCGACTTTACCCCCGCTTGTTTTCATTATCACGGTTGACGGCGT
TTTCGCCATACTCGAAGACCATAAACGCCACCAGGCCGACAATATTGCCAATGCAAGTCCGACCCTCGTGCTTGACCGTGAAGCGAGGAAATTTAAGCAA
GTCACGTGGGCCGACGTTGTGGTAGGCGACATTTTAAAAGTTACAAACCGTGGACTGGTACCAGCAGACATGCTTGTGTTGGCTGTAAGTGAAGTTCCGA
ACCAGCCGCCGTGCGGGATTTGCTATGTTGAAACCAAGTCTTTGGATGGAGAAACGAATATGAAAGTCCGATCTGCCATGGAATGCACACTTGCAGACAT
GGGTTCAGATGAAAATTTGCTAAGAATGAAAGGTGTCATTCGGTGCGAACGCCCCAACAATGCCATCAACAGTTTTCAAGGTGTGCTCGAACTGGAGGGA
AGAGAAAAGGCTTCCATTCCGTATGAAAGTATTATCCTACGTGGATGTATCATCCGCAACACCGAATGGGTGCACGGTGTGGTGTTTAATACTGGCAAGG
ACACGAAGATCATGATGAGTAACTCAGCTCCACCATCAAAAATGAGCTCAATGGACCGGTCTATCAACCAGTATACAGTCGTGTTGTTGGCAATTTTGGT
CGTCTTCAGCGCTGTTGGTGCTACAGGAGCCGTGGCATGGAAGACAAACCATGACTCGTTGTGGTACCTAAAGCAAACAGTATCCGACAACAGCGCCATT
GTAGACTGGATCATCATGTGGTTCTACTATTTGCTACTCATGTACCAGTTCGTTCCTATTTCGCTAGCTGTATCCATGAGTATGGTAAAGTATATCCAAG
CGCAGTTTATCCAATGGGACATCAATATTTACCACCCGGACACGGACACGCCAACACTGGTTCGCTCCATGTCTTTAAACGAGGAGCTTGGGCAGATTTC
ATACATTTTTTCGGATAAAACTGGTACTCTCACCTGCAACGTTATGGAGTTTCGAAAATGTTCTATTGGCGGTGTTTCATACGGCAACGGAACAACGGAA
ATTGGCTTAGCAGCTCTTCGACGTGCTGGTAAACCTCTTCCAGACATGACTTTTCAATCCAAGGGGCCTAAAGTCCCTTATGTGAACTTCGACGGTCCAG
AGTTGCTTAACGACATGAAAGGGAACTCGGGGTCTGTTCAACAAGGTCGCATCGATGCGTTTTTCACTCACCTCGCGGTGTGCCACACCGTCATCCCGGA
ACGCCATGAGAATTCATCCGAAATCACACTTTCGGCTTCCTCCCCTGATGAGCAGGCATTGGTGGCAGGTGCAGGTTACTTTGGATATGAGTTTGTGAAT
CGATCTCCTGGAGTTGCCCACGTCAAAGTTCGAGGAACAGTTCAAAAATACGAAATGCTGGATGTACTCGAATTCAACAGTACTCGAAAGCGAATGAGCA
CAATAATTCGCCACCCGAACGGCAGGATCTTCTTGTACTCGAAAGGCGCAGATGTGATTATTTATGGACTGCTCGAGAAAGACAGCGAGGAAGAATCGAC
TTCTTCGCAGCTCCAGGAGATCACCCGGCGTCACATCGACCAGTACGCTGAAGATGGGCTTCGCACTCTCACGATTGCAGTTCGTGAGATCGATTCTTCG
TATTATTCGGAATGGGCAACACGTTTTCACGACGCTCAAAACAACTTGAATGAAATCGACAAGCGCAAAAAGGACCTTCCAAACGAGATTGACGCGTGTA
TGAACGAGATCGAGTGCGACTTGGAGCTACTTGGGGCAACTGCAATCGAAGACAAACTGCAATCTGGTGTCCCTGACGCGATTGCCAATTTGGCCTGCGC
GGGGATCAAGATCTGGGTGCTTACTGGCGACAAGGAGGAGACTGCCATCAACATTGGCTTCGCTTGTCAACTGGTTACGAACGAAATGAAGCTTTTCGTT
ATCAACTCCAAGAATGCACCGACCTCTGAGATTCTCGAAAGTACTCTGAGAGATGAAATCGGAGTCCGCAATGGAGATGTCACGGTCTACCTGGCTTCAC
CACCGAGCACCAGAGGTGAACTACGGGATTTGGCTCTTGTTATTGACGGCGAAACACTCATTTTCGCTCTCCATGGATCATGTCGCTCCCTTCTAGCTGA
GTTCTCTCAGTACTGCAAAGCTGTTATCGCATGTCGAGTGTCACCCGCTCAGAAAGCTGAAATGGTTGCCCTGATCAAGGAATATGTGCCTGGTGTTCGA
ACTCTTGCTATCGGGGATGGAGCTAACGACGTGTCCATGATCCAAGAAGCTCATATTGGTGTGGGTATATCAGGACAGGAAGGTATGCAAGCGGTGAACT
CGAGTGACTACGCGATTGCGCAATTTCGCTACTTGCAGCGTCTGCTGCTCGTACACGGTCGCTGGAACTACCGACGCATGGCTCAGCTGGTGTTGTACAT
TTTTTATAAGAACATTCTCTTCACCGCAGCTCAGTACTGGTATACGCTCTTGTGTGGATTTTCCGGGCAGAAATTCTTCTTGGAGAGCGGCACCCAACTG
TACAATATTTGTCTTACTTCGATCCCGATCGTCGCAGCTTCCATCTTGGATCAAGATGTCAGCGATGAGGTAGCCATGACGTTTCCTAAGCTCTACTTCA
CGGGACCTCGCGATGAAGACATCAACACTCGCGTTTTCTCGCTGTGGGTTGTGGGTGCGATTGTGGAAAGTGTCATCATCACGTTTATCACGCTTCACAG
CTTGCAAAGCGCCGGGTATGGCGGAGCGAGTCCGACGATGTGGCTGGAAGGCTTCCTGGTCTTCACCCTAGTCGTGTCTATCGCCAATTCCAAGCTGTTC
ATGTTCCAGAATAGTTTCCATTGCTTCAACTACGTCCTCTACCTTGGATCGGTGTTGATGTGGCTACTGGTCGCCTTGGTGTGTAGTCACATTTACTTCC
TCTCGGATCTCACGTGGGAGTTTATGTTGGAGCAAGCGTTCGTGCTTCCATCCTTCTGGCTAATTTATCTGTTCGTTCCGGTGGCTGCGCTCTCGTACGC
ACATCTTCTCAACGGTATCAAGTCGACGTTCTTCCCAGAGTACTGGCACCTCGCAAAGGAGGTCATCAAGTTCAATCTTGATCGCAAACTTCTGCAGTGG
AATGACAATAGCGACGCGTCCGTGGCAGTTCCCGCTCGACTACCTCATGGGAAAAGATCCGGCAAGAAAGCTGGTTCCATTATTCCAACCAACGTCCGAA
CCCAGCAGCACAGGACAACGCTACAGAAGGCATATCATGGGTTTGCCTTCTCCAAAGATGGGTACGCCGGGGCCACAGAGACTCGGTTACTCATGAGTCG
ACGCTCCATCACAAGTGCAATAGAGTGAGTGAGTTTAAGGTTAGGCCCTAGCTGAATTTTCACATATACATGACAAGTTATGAACATGCTACTTATTCCA
ATTCACACAATTGTTCACTTAGTAGCGAGTCGTAGGGGCGGGGCAGGTACAGCGTTTCCTCTCTCCGCGTACCCGATATGGGATCGTATTCTTGAGTTTG
GAGGCGAGAAGAACAGCAGTTCATCAATCACTCGGGGCCTTCCCTCAAGTGTCATAGCTGCGTCAGGTCGAAAGGCAACAGCTTGGCGAAGAAATAGCCT
AGTAGTATGACACACCTCGGTACATCAGCATCTAGATCAGCAGTATAGTAGCCGAAATACTGGATTACACGCACCTGGCGGCGATTCCTTCCAGTCTCAC
GCTCCGTTCCACCTCCGAAGTGCGTTCCTCTTGTCGTTTGGTCTTTGCACTCTGGTATTTTTCTATTAGCTGGCGCTTTTCCTCTTCAGTCGCATTTGCC
AGTTGAAAAGCGAGGTGTTGGGGGCTACAATGAGTTAGCCGCGCCAAGCTACGCAGATTTCTTGCAAAACGAAGTCGCTTCACAGTGCTGATGATTTTTG
CGTCGTGTTCCAATTGTTCTTGGCGCCTAAGCTCTTTCAGTCTCGCGGCTTCAGATGCTTGGTGCGCCGCTACAATATCGTCATCCACATTTGATACAGT
AGCGGCCACTCGCCTTGCACGATTCTTCTTGCTTGTACGCCGCACCACCAGCCGCTCATACAGGCGGTTGAAGTCGTCGGCCATTTTCCAAATCTCACAT
TTTTTACTTCGAAGTATTTTATCAAAAATTACACGCAACATTACTTTTGGGAAGAGGTGTAAAGTTGCACGTAGACGAGCTGCAACCACCAACAAGGACA
TGTTGCGCGTGCCCAGCTTGCTCCGAGGCCTAACTGCTGCACCGCTACGGCGCGGCACCTTTCTCAAACGCTCTTCAGTGCGCGCGCTCAGCGCTCAAGG
TGGTGACGGCGACGACGATGATAATGGCCTGGAGCTGGAGGACCTGGAGCTGGATTGGGACGAATTGGACGATTTGGAGGACGACTGGGCGCTGGATGAC
GAAGGAGACATAGCGTCTGCAGGTCGCCGCAAGGTGGAGGAACATGTTAAGCAGAAGGTAAGTGTGCGACGTGCAAAGCACTCGAAGCGCCGCTTCGTGG
ACCGTATCCGCGTCAAGGCCACGGGCGGCCACGGTGGCAACGGCTGCGCCAGCTTCTTCTCCGAGTCGGCCATGCGCAAACGCCCTAATGGTGGGCATGG
AGGCGCAGGAGGTGACGTGGTGATCGAAGCCAGTGATAAGATGCAGAACCTGGCAAGCGCCACGCACCACTTCAAGGGCGGAGCAGGCACCAACGGCATG
CGTACGTCGTACAATGAAATGGGGAGGAGTGCAATGCTTCTAGTGAGCTGACTGTTGCTTTATGGCTGCAGCAAACGATTCCGCGGGTAGGAGAGGGAAG
CATTGTCATGTTAAGGTGCCTTGTGGCACCCTCGTCAAGCGTGTGGAGCGCTACGAACGCGAGCTCGAGGACGGCGAGTACGAGATCGTAGACAGAATGG
AAGTTGTGGCTGACTTGGACACGCCAGGTGCTGCGTTCCTCGCTGCTAAAGGTGGCAAACCTGGTCTGGGCAACCGTATCCTGGCCGGTAAGACGACCAA
GTTCGGACGGCTGCGCAAGCACATGCCTGAGAGCAAAACTACAGGCTCACCTGGTACATCGCAGTACTACGAACTGGAACTCAAGACAATTGCCGATGTG
GGTCTTGTGGGATACCCGAACGCTGGCAAGTCTACCTTGCTGAGTGTGTTGAGCCGCGCCACACCAGAGATCGCACCATACCCGTTCACGACACTTCACC
CGTACGTGGGCATTGTGGAGTTCCCGGACACGTTCCGGCTGAGTATGGCCGACATTCCCGGACTTATTGACGGTGCACACCGCAATGTCGGTCTTGGTCA
TGACTTCTTGCGTCACATCGAGCGCACAAAGGTATGGGAGATGTGCTGCATATCTGAACGGGACACGCTCAATAACCACAGTTTGCTGTGTAGATCTTGA
TGTATGTACTTGATACAGCAGGCTCAGAAGGACGTGATCCCTTGGAAGACTTCACCCACCTTCAAAGAGAACTGGAGCTGTATGCTCCAGGAATCTCGTC
ACGACCTTCCCTCATCGTTGCAAACAAGATGGATGAGCAAGGTAAGGCTTGTTTCTATTAAATCTATTGTATCGGCGATGGTGGCGTCATTCTGTACTCT
AACAGAGCGCGTGCTGGTCTCACCACAGGCGCCGAAGACAACTTTCACAAGCTGCGCAAATCCACCGATCTGGCAGTGCTTCCCGTCAGGTAAGTAGCGA
AATATCTTTCATTCATAACCCCCACTAACCTCATAATGTTCCTTGGGTGAATAGCGCACTCCACAAGGTCGACATTGATACGATAGCACGCACGCTCCGA
TGGATGATCGAGAGCTATAGCAAGCTTACCAAGTCTTCATAGATGGAGTATTAGCAGAATGGCCATGCACTCAGCAACAAAAAGGGCTCATATCACTACT
GTTTTGACTTCATCTTAAATTGTTGCACTATGTTTTTGTTGCGTGGTTATTTATAAGGCATGCGGGTCAAGATGACAAGTCTAATTTTCAACTTAATCAG
AGCCAAGGGCTCCACCCAGACCGAGCGATGAATCGCTATGAGATATTGGACAAGGTCGGTGATGGGGCGTTTGGTGAAGTTTCGCGTGCTCGGAGCCTTA
AGACCAAGGAAATTGTAGCTGTGAAGAAGATCAAGGCACTATTTCCCACATGGGAAGAATGTCTTCAATTGCGTGAGCTCAAGTCGCTTCGAATACTACG
CCACGAAAACATTGTGCTACTGAAAGAGGTTATTCGAGACAAGGAGGAGCTCTACTTCGTGTTCGAGTACCTACAGACGTCGCTTTTTCTGGTTATGCGT
AACTTCAAAATCTCATGGAGGAGGCAACAACTACGCTGGCGTTGGAAATGACTCCAGCTCAACCTCAGACTCTTCCACTTCTCATCCCTGGTTTTCGGAG
GTGCAAATACGCTCGATTATGTTCCAGCTCTTCAGTGGCCTAGCATACATGCACAAGCACGGCTTCTTCCACCGTGACATCAAGCCTGAAAACTTGCTAT
GTCACGAAGATACGCTCAAGATTGCAGACCTGGGTCAAGCTCGCGAGATCCGATCACGGCCGCCTTTTACCGACTACGTTGCAACGCGATGGTACCGGGC
ACCTGAGCTGTTGCTACGCTCGACGACATACAATAGCCCCATCGATATGTGGGCCTGCGGGTGTATCCTTGTTGAGCTGCTGATCTGCACGCCGCTGTTT
CCTGGAACGTCTGAAGCGGATCAATTCTATCGAATCTGCAAAGTTCTTGGTACTCCTACGACGGAAACATGGCCCAAGGGTGCAGCAATGGCTTCCCATA
TGCAAGCTCGATTCCCTAAGTGCACTCCCGTGTCTTGGAAGCGAATCCTGCCGTCAGGTACACCGTCTTCAGCTGTTCAGCTTGTACGAGATCTGCTACA
ATACGATCCAAGTCGACGGATTACAGCAGCGCAAGCCCTTCAACACCGCTTTTTCGATCAAGCTATGCCAAGACCAACGCTAACAATACCTCCATTAGTA
ACACCAGTGCAAGAAGTGCCCGTGTTGCCGCTTCGGAGCGATTTCAAGTCTGGAGGAGGCTACTCGAGTTATACAGGACGGTCAAGTGTCTGTGCGAAGA
AGTCGGACGACGTGGAGCATTGGGCAGGAGGGTTATCGTCACGACAAGAACACCACTTGTTGACTGCCAATAAAAGACAGCAGACTCATTCGCGGCACCA
GGACTGGGGCTCTTCTCTTGTTAGTGCTCGCCCTGGTGGATATGACGACGTAGCTGACATGAAAACTGTTTCGCCTATACAAAATGGAGGTGGAAGTGGC
ATCTCCAAAGGAGGCTCCATAAAGAAGAGCTGCAGCTACAACGCGCTTGTAAGTGAAGGTGCCACTAGGAAAATTACATCGGAAGACAACAGCGAACACG
ATGACGACACTAAAAGTGATAGCACATTACTACAAGACCTGCTTGATGAGATTCTAGGATAAATAAAAAGTCAAAAGTTCGCGATAATTTCATCAGGTAT
ATTGTTCTTCTCATCTCATTCCGTCGCACACCATGCATCTACACAAGATAGCTAAGAGCACTTAGAACTTGAGGGCGTGGGCGCGGTCGTTCTTGGTCAG
CGAGAACTTAGCGTTCAGGTACGACTTGAGGAACGGCTCGGCCTCGAGCTTCTTGATCAGAGCCGAGTCTACAGCCTTCTGGTCCTTCTTGCGCTGCTCC
GGGATAACGGGGGCCTAAGAAATATGACAGCAGCACGGTCAGTCTCTTATAGGGAGCTTGTGTGCCGAAGCAAGCGATCCCAAGCGCTCATTTGGTGCGG
CAGGATGCAATGTCCGGAGACAGCAAGGCTCCCTGCCTGATCCGCCACGCAGCAAGCGCTTCAGCAATCTAAGAACAAAAGAGATCCCAAAGGGTTCGTC
GATCTTGTTCATCCATTGCGTCACCACTTTACTGCTTGATGTGGACAGACCGTGTATTGTGGTCTCGAAAAACCGACCAACCGGAACGGGATGCTCACAA
GGGCAATCAAACATAGCCATAGTACTTACAGTGCTGGACTGGGCAAAGAACTGCTCCTCCTTGCTCTTCTTGGCGGCTTTTTCCTTGGCAAAGTAGGCGT
CGTCGATGGCAGGAAGCGCCAGACCCTCAATGTTCACCTTGGTGGACGTGGCGATCACGTACGACTGGTTCACGCGACGGAGCGGCACACCGTTGACCTT
GTACGGGCCTGCAAAATATGAAATAGCACTGTCAGTAACTGTGTTTTCAATGGCATCAACTTGTCCCCTTGATCCGACATTCCTCAGGTCTCATAATCTG
ATGGATCTTCGGCAAAAAGTCACCCATCACCCATCTGAGTAAACAACCATCGGAAACCGCATGCCCCACGGCGGCCTCATCGGCACCATGCACCTTGTAA
AAGGGAGGTACGGACAAAGCCACTGAACTTAGCATGAGGCACGAGACGAGGAAGCCCAACAGACGAATGATGGGGTGGCAGAGCGCCTCTCGAAGTGTCA
TGTTTTGCATCATCAGAATGTCGGCTGAGGTCGATACTTCCGGACTGCATCTGTCACTTACCAGTGACGAGCAGCAGGCCCGAAGCGAGCTGGTTGAGGA
AGACCACGCGCTTGCCACGGAAGCGACCCGACAGAAGGATCAGGACCGTGCCGGGGGTGATGGACTTGCGCAGCTTAGCGGTCTTAACGCTGTTGCGCTT
GGTCTTGGCCGACGGCAGCGGCTTCGGGATGTAGTCAGCCGGGTACCACTTCTTGGTGGACACCTTCTTGGCGGCGACCTTCTTCTCGCCACCCTTCTTG
ATCATCTTGCCACGGCCATTCTTCTTGGAGAGGCTGTTACGCGAGATGGCGTTGATGCCACGGGCAAGGACGACGTTGGTAGTTTTCGGCATGGTGATGA
ATATACCTGAGTTGTGGATATGAACATTAGGGTACAGGCTACAAGCCGCAGCGACATAACGGTATCAGCTTACCTGTCTGAAAAGAACTGAGCCAGATAG
TGCTTTTGACCTGCCGTAAGCCAACCACAGCCAACCAGAGAAGATGATGTGGTACACGCAAAAAGAGAGCTGCCGTGTTGAAGCCGACGGTTCAGCGGTT
CAGGTGGCCCGGTCCTGCGGTAGGGCATTTCAAATGTTCATGCAATCATGCTTAATCGGCAACATAAGTCTCATTCCTTGCGCAACATGTCTTTTGTTTA
CGTTGCCTATTTATGAATGCGCAACATTACTTCAACTCAATATTTTGCCTTGAAGCGGTACATACAATTCAGATCACTTCCTACACGACAGTCTTCATTG
CACCACGCCTACAGCAAGAAGAAAATTCAGCTCATGGGAAAACGTAAGGGACGCCGTGCAATCGCTACCTCAACATTGGTCGACTCCGTGACATCTGAGA
CGGCGGATCCTTCGTGTGCTGGTGGCTGTTGCGGTGGCGTCAGGAGCGACGGAGGAGAAACTGCCGCATCCTGTTCCAGCAGCGACGAAGAGGTTAACGC
GGCTGAAGACGAAGGAGGATCCGCTGATGGCTGCTGTACTGGGAAGGAGAAAGAGGCTCTGGACGATTGCTGCTCCTCCAAGAAGGGCACTGGTTGCAAC
AACAGTGACACTGCTGAGACGGCGAATGGGGCGGCGGAGGCTGTGGGCGTTGCAATCGAGCAGGAAAGCGGCTGTGCCAATGCAGACCCTAAGCCATCGA
GCTGCTGTTCATCAAAGAAGCGGGAGGCTTCTGCGGAATCTGTTACGTCCCAGGAAGTGCCCAAGAAATCTAGTTGTTGCTCGTCGAAGAAGCAGAAAAC
AACTGATGATTCTGGTGCTTCTGAGGAACAGCCAAAGACATCCGGTTGCTGTTCTTCGAAGAAACAGGAGACTTCTGGTGGATCCAAGGAATCCAAGAAA
CCTAATCGTTGCTCATCTGATGCTCCTGACGCGTCCGAGAAGAAGTCCAAAAAATCAAGTTGCTGCTCATCAAAGAAAGATGAAGCTCTAACTAACTCCA
GCTGCAGTTCATCGAAAACTTCAGAGGTTGCAGTCGAAGTTGACGGCTGCTGTGCGTCTAAGGAGAAGAAGATATCATCTGGATGCTGCTCGAAGGAGTC
AAACGTAGAGGCTGAAGCTAAGAAGTGTTGCTCCTCCAAGGAGCCAAAGAAGTCCAGCTGCTGCTCATCCGACGCGTCCGAGACTCGCTCAGATGGCTGC
TGTTCGTCGTCCAGTAAGACCAAGAAGACGCTCAGTTCAGGTTGTTGTTCATCCGAAGAGCAGGATCTGCCGCATCCGGAGAGATCTCCTAGCTTTTTGA
AGCGATTAATGCAGTTCCGCAGCGATCGTGGGGCTTCTCTCGAGAAACAGCGACCTCAGTCGGGCAGCTCAGGAAGGAAGAAGACAACAACCGAGTCCCT
AGAAATTCTTCGCTTGAACATCAGTGGAATGACATGCAGTGGTTGCTGCACACGCATCGAGAAGTTCATGAGTACGCAACGAGGTGTTACGGACGTAAAC
GTGAGTCTGCTTACGAGTCGCGGGATCTTCCAGTTCGATCCGCAACTAGTCACAGCGAAGCACATCGAGAAGACTGTGGCCACTTTGGGGTTTGAACCCA
GTGTGCTGTCCAGTGACGAGTTAGTGAGCGTTGTTCTGCAACTTGGACAATCCGAGAGCTCCCTGAAAGCCAAAAAGGTAATAACTGAGATCGATGGCGT
CGTCTCAGTTGAAGATATCGATGAACCAGCGGTATCTTCCGCTTCGCAAGGCAAGGCTTTGCGGGTCGAGTACAACCCAGACGTCACAGGTGCTCGTAGA
ATTGTTCGCCACCTATCTCGTGAGCTAGGTTTTACCGTTCAAGCGTCAACTCCGCAGGCGCCATCTGTCCGTGCAGGCGAGGAAGAAGTCCGACGCTTTA
CGAGGCTCTTGTTTTGGAGCTGCTTGCTGTCTCTGCCCGTAATCTTCGTCGAGTTCTTGCTGCCGGCGTTGTATCCATTTTCTGATGGCAACCCAGCAGA
CGTGGGCTTATGGGGCACTGCCAACCGTCTGAGTATTAAAGATGCGGTGGAATTGGCGTGCGCGACGCCTGTACTCTTCATTGTGGCCCGCCCCATTCAC
GAGAGCGCCTTCCTCGCGCTTCGGTACGGTGGACGCGTCACAATGGACGTTCTCATCTCGCTAAGCGCCTGTACTGCCTTCGCATTCTCCGTTTTCACTG
TCGTTTGTGGAGCACTTGCCATTACTCAAGCACAAGAGGGTGTGACGGATCCTTCGACCGCGCCCCCGCCTCTCGTGGAGACTCCTGCTAAAGCTGACAC
TTTCTTCCAAGTCACGGTACTGCTGGTTACACTCATCCTCGTCGGCCGCTACATCGAAACACTGGTTAAAGCACGTGCCTCGAACAGCGTGGACGCGTTG
CTGCGGATGCAAGCCAAGACTGCCATTTTGCTCGAAGAAGGGGATCAGAAGGAGCTGTACATTGATGTGGTGCTCGTTGAACGTGGAGATCTGCTGAAAG
TACTACCTGGTACACGAATTCCGACGGACGGCGTGGTTGTTGGAGGTGCTAGCTCAGTGGACGAGTCCATGGTGACGGGCGAGGCTCGGAAGGTGCCCAA
GGAGTCTGGGGCAATTGTGATCGGTGGATCTATCAACTCTCAGGGCGTTCTGACAGTGCGGGTAACTCACACTATTCACGAATCCATGTTGGCACGCATG
GTGAGACTCGTAGGAGAAGCTCAGGCGTCTCGTGGTGTACGTCAGAGCATTGCAGATGCTGTGGCCGCATACTTTACGACGTTCATCATCATTCTGGCCG
GAGTGATGTTCATTCTCTGGTATTCGCTCGCTAAGCACGGACATGTGGATACTCAAGGCTGGGCTCCTTTCCCGTTCGCGCTGCGCTTTGCCATCACCGT
GCTAGTCATTAGCTGTCCGTGTGCGATTAGTCTAGCCGTGCCGACTGCAGTGATGGTGGCGACAACGAAAGGTTCGCAGGTGGGTATTCTCTTCAAGGGT
GGACGCGCATTAGAAGCGCTTGAAGAAGTGGATGCTGTTGTGTTCGACAAGACGGGCACTCTCACGACTGCTCAGCTTGGCGTTGCTAATGCCTTTATTC
CGCAAGATACTTTTGATAAAAGACACCTCTGGAGCTACGTAGCTGCCGCAGAGAAAAGTAGCGAACACTCCATTGGTAAAGCTCTCGTAGCGCACGCAGA
GACTCAGCTTCAAGGCTCACAGGTCGAAGAAGTGCAAGGATTCGAGGCTATTCCTGGTTGTGGTGTACACTGCACCGTGCGAGGTGTTGATGTGCGTCTT
GGATCTCTTACCTGGCTTAAACAGCAGACTTACAGTGACTGCCGCGCTCTTCGAGTTCCTGCCGAGTTTGTCGAAGCAAACCGACGTTTCCACTCTCTGG
GCAGCATTGTGGTCTTCGTTGTCATTGATGGAGAATTGGTAGCTGCAGTTGCGCTGCACGATACACCGCGTCCGGAAGCTAAGCGTGTCATCGAGCAGCT
GAAACGAGATGGAGTTCAGCCATGGATTGTAACCGGTGATCAGCGTGGCACAGCCATGAGTGTGGCTGCAGCGCTGGGCGTGCCTGAAGGTTCTGTGCTT
GCTGAAAGTTTGCCTCATCAAAAGGTGGACAAGGTGCGCTTGTTGCAAAGTCTGGGTCTGCGAGTTGCGTTTGTTGGGGACGGCGTGAACGACGCACCAG
CGCTGGCAACGGCCGACGTCGGTGTCGCACTTGGGGCTGGTACTGACGTGGCACTCGACGCTGCTGACGTTGTGTTGGTTAAGGATGATCTGCGCGACCT
GCTCAATGCCCGAGCACTCTCGAACGCCACGAACCGACGAATCAAGCACAACTTTGCGTGGGGATTCTTGTACAATCTGCTGATGATGCCCATTGCATGT
GGCGTATTGTACGCTCCGCTGGGGATCTGGATCCCTCCGGCCCTCGCTGGTCTATCCGAGTTGCTATCGTCTGTGCCTGTGATCCTGTTCTCACTTCTGC
TTAACCTTTGGAAGCCGCCGTTTGGTGGTGACTGGGGATTAAAGCAGCAGCACGTAGCAATCGACGTGACGGAGTCGACTCCTCTGCTGCTGAAGCAGCG
CTAATGAACGGTGGACACGGTAGAAACACTGGCTGAGAATTAATGTTCGTTTTTGCTCACTTTAACGAGTTGTTTGCGTCTCGTTTTTGCTAGTTAGAAG
AAGGTCTCGTGTACTGCAGGAATGCTGCTCTCGCGTGCATGCGGATTGTTTCACAGTCTACTGACAGTGGTTTGTCGCCACTAGTGCCGGAGACAATAAC
ATCGAACCGGTTAAGAAGCAGCTCGACGTCCTCGGTGGCTATGGCAGGTTGGGGGCTCTCTGTTTCGTTGTCAGTCAGTGTGTCCTGCGCGGCGCGCATG
TCGCGAGCAACTGTAGCTCCCGAGCCACAGGATATACGTGCTGGTGTGGCGAGTGTCTTTAGTTTTTCTCCAAGCCGACAGTCGCTAACAAAAGCGTCGC
GTTTAGCAATCGCCTCCTGTTCGGCTTGTTCTTCTCGCTGTTGCTGCCTTTGCTTCTGCTCCTCATCAGGTTCGTCTTCATCTCGTGCAGAGCGTGGGTC
AGGCGTCATCTTCAATTGGTAACGTCGCTGCAAGGCCTTGAGCGAGAGTGCAAGATACAGACAAGCCGAAGATCGCACCGGCATTTGCGGAAACTTAGGA
CGCTCACTGCCCAGTGCAAGCAGCACTTCGTTGAGTGCAGCTCCAAGTTGCTGCTCTAGTTGTCCCGGGTAACTCTTCGCCAGAGTCACTTGCGGTGGTA
ACTTCACTGGCAAACTCTGCGAGGTGTGTCGAGACGGTTCCGCGCAAAATTTACGCCGTGCTTCTTCCGAGACGAAGAAATAAACTTTTGAGCGGTACGA
TGCACGGAAGAAGACATTGCCATGTCGAAGTGCAGCCCAATCCTTGGCACCCGAACCCGACGCAAACGTGACTGGGCAGTAGCCTTTCAACTCGGGAAAG
TCGCAGTCTGGTACAGTCAGCAAGCTCAAGAGTGAAGCGTTTACTGGAGCTCTTGCCACAAGTGTCTGCGCCTCACTCTCGGCTTCTTCTTGTGTCGGCC
ACGACTCGTCTGATGGTTGGTCTGCCAGGTATCCGACAAAAGCTTCAGGACTCGCCACAAAGTGCTGGAGGTTTTGTTCATCTCGAAACCAGAAACTGAA
CCCTCGGAAGTCTACACACAAGTCACGATTGGATTGACGCGAGTGGTAGAATCTTCCGACACGCAGCTCCACGGGACAGAATGTCTGGAAAATAGGATGT
TGACGTGCTTGCAGCTCTTCACGCGTACGCACAACACCTAGAGCTCGAGCAGCTCGACTGGATATCATTGCTATGGTGTGATGCGATGCCAACTGCTGTT
GCTCGGTGAGGAGTGCTTGAGCCTGTGCTGCTGCATGCCAGAGCGAGCTGCTCGTACTGTCCAGTTGTCGTATGTGGAAAACACCAAAGCGACGAATCCA
AACATCGACGAGCTCCAAGCGGTAATGGTGCCACCGTGCAAAACCAGCTCGAAGATCGCTCTGCATCACATTGTTCTGCTGCACCTTCCAGACACTGGCA
AAGCTGCGTTCAAGAACGAAGAGCATGTCCGGTTGAATACTCCCTGTTTCGTTAGAATTCAGCAGACTGCGTTGCAGTTCGTGATGGCTTAACAAGTACC
CGTCGAGAACCCAGCCACGTGTCTGGCACTCGGAGGAACGCAGTCGAGTGCAGATAACTTCATGAGTGATATCACGATTGGCGAGAGGATCAAGTTGCTG
CTTCGTGATCTCTAGTAATCGACCGCGCAACGTGGAACCGCCCTGACATCGAATCACCCAATCTACAGCACTTTGGGGAGATACGTAGACGAGTCCGAGG
GCGTTGGCGAGTTCTTGAGCCACTCGCGTCTTGCCTGAATATGGAGCACCCACCACACAACACGTTGACTGGTGTCTTGGTGGAAGACTAGATTTATCCA
GGTATTTTGACGGACAAGCTATAAAGGCACGACGAGCTTCACGCGATCTCGGGAAGTAAAGTTCGTCTCGGTATACAACCGCCTTCATTGAGGTAGTCGA
TGCAGAATCCGTACGACCAGTAACAGGACAAGCCAAGCCGTGCTTACCGACAAGAAGTTCTCCTGACGCTAACATCTGATGCATTCTGCCTCCCGCCGAC
ATGTCCAGAACTTTGCAACGCTCGAACAGTGTCTCTCGTCCAGCCATAAAGTCATTGAGTATTCTTCTCACTAGTTTAGCAGCTTGTCTTGGTGCGTTAG
TCGCATCCACCGAGTCGCATACTCGGATACCTCGAGCTCGAAGTCCAGCAATAGCCTCATTCAGAGCTGTCTGGTCCTCGGCGAATTGTTCTTGAAGTCG
AGACATTTCTTCTTCTCGGGCGGCTTCCAAGTCGATCGGTTCTTCGTCTGCAGCTTCTTCTGGAAGGGAGACGTCGTTTTCAGCATCGCCCTCCACCTCC
TTTTTCCGCGAAAGAGCAAGTTTCCGACGAGGTACTGGTAGAGTGGCAATCCATCGAGCCAACAAAGTGTTCACAGCCTCCTCTTCCGATACCGTCACAG
GGACTACTAGTGCTGGAAAAAGACCGTTCTTGAAACACATTTCCAAAGTCGCAGCGCTTGGAATCCGTGAATCGTCGGGTCCCAGTCCGACGATAACTTG
AGCCACAGATTTTTCACTGTTTGACTGGCGTTGGAGCTCAAGTTGGAGCGCTTGGACATAGATTTCTTCGGGTGGATAGCGTGCTTCTTCCGACTTGAGT
TCTTCCAGCTGTCCGTTGCGCTCGGCATTTTTTTCAACTGCAGTCAAGTCCACAATCACATACTCTGCAGAGGAATTACTTTGTTCCGTTTGTGGCTGAG
CTAGTGCTGCAGCGATTCGACCGCGTCCTGAACCTCGAACACCAAGTAGCAGTACACATGGCACGAAGTTCGCAGTTGCGCAAGGGCCATCAGGGATGAA
GTATCCTGGATTTCGCTCGAAATCTCGACGCTCGGATTCGCCAGCGAACGCGTAGAATTGCTGTCGAAATGAACAAATATGAGATGGCAGACCTGGTATC
AACAAACCACGTGTACGCCACGACACAGGGCAAAATCGACCACACTCTCCTTGAAGTTGTAGCGCTCGATTTCTTGCTGCTCTAGCTTGCTTTTCAGTCT
CAGGATCCGGTGCTTCGGACTCCGCTTCTTCGTCTTTTGGAGTCTTTTTCGTTTCCTCATGCTCCTCATCATGTTCGGGAACGAGTGGGGCAAATATCAC
AGCTGGATCGTACTCATCAACAAATTGAGGAGCGTGTCCAGCTTCGATACTATCCAAGCGCGCTGCAATTGGGTTTAGCTCGCGATCAATTGCTGCCAAC
GTATCACACGGCTGGCGGAACAGTGGACACGTTACGACTCGAGGTACGCTACCAAGGCCTTGTGAGATGTCATCAGCGCCAGCTTTTTCGGTCTGGAATT
GTTGACGTCGTATAGCGGATAAAGCATCAGCAGCTTCGAAACTCTGCTCTTGATCCTCATCTTGAGCGACGACGTCTCTGTCCAACACCAGAATTATGTC
GGGAACACATCCATGTTCAAGTAAAACAGCAGCGACGTCACGAGTGAGAGGCAAATCTGTGATCATCCAGCCTGTTGGCGTGTTATATTTGGCTTCCAAG
GATTTTACAGCTTCAGCGGCCACTGTTGCAGCTTCAATCGGGGAGACAATCTGCCCACTCATGAGACGCATTTCCAAAGAGATACTTGACGTCTTGAGCA
ACTTCGAAGGAGACACAGTCCGCACATGGAGTCCCGTCTCTAGTGTCTCCAAGTACGAAGGTGTCAAGACTTCGCATGCGCCAGTGGTGACGAGCCAAAT
TTTGTGGTACGCGGATGGAATCGGGATATTTTTACGTAAGTACTGGAGCGGGTGTGCACAGAAATCACGTCGTGTTTCTTGTGATGCCAAAAAGTAGACT
CGTCCGGAAAAGCATGCAGCAAATTCAGGCTCACCAAGCCGCAATATGTTCGTAGAAGTCGACAACACGGGACAAAACTCGCGCCATCTTGATAGTAGTC
TGCGGTTTGCGTCTCGTCTAGGCAGCCGTGTAAACATCTCACTTGTTTCAGCTTCAAGAAGTGTACTCCAGTCTCCATAAAGAAGCCACTTTACTTTTTC
AGCGCGGCTAGAACCAGTCAGATCGTCCGGCAGAGTTATTGGACAAGCTTCACGAGAGGTACTGAACCGCGAAAAAGCAAGTGAAGTCTAGCAAATTGAA
CGCAGGAGTGAGCATCATAACAGTGATTGGTAAAAGTTGCTACAAGGAAGTTTACTTACCCCCGTGATCGCTTGGATGCAGTGATCTCGAATGACATTTA
GAGATTGGGTTGCCAGTACCACCACTAAAGGACAATTTGACTGGGTACGCGCCGTCTCTACAGCTCTGCGCGTTGAGAGTTCGTGTTGCATGCGACTCAT
GTAGTCGTGATATCCCTTACTAAATCGTAGCACACTCAATGATCCGTGTGGTAAGGTGGGCTCATTTGGTGGCTCAAACTCGTTGCGTTCTGCAGGAGTT
GGTTCCGGTGGTGCTGCAGGTTCGTATGGTGGCACGATGCTGTTGTCTTCGTTCTTTTCCTCATTTTCACCCTGATATGCCTCGACGTCTTTGTCTTCGG
CGTTTAGATCACTTTCACCCATTTCAGCATCAGCACTGTGCTCTTGCAACTTCTCACCTTCTATTTCCAGTTTCTTTGGAAGCAAAAGGAAATCGGCAAA
GCCTTGGGCTGCTAGCTCCTCGCTACTTGTCGCTCTCAAAGTGGCAAGCTCCCGCACTGAGTACAATCGGCCAGCTACAGGTGCCAACTCGGAGCCTTTA
AGCTGAAATTCCAGTTCGCTGGGCAGCGCAGTGAGAGTTACCAAATAGTCCATTGCTATTTCATGCTTTTGGTCATCTAAAGACGACAGCTCGCTCGGAT
ATACATCATCCATTACCACTCCAACGCCAGCTACAGCAACACAGATCACAAATACATTAAATTTTTGCATCACATTCCTTGTCCAGACAAAAAAAACGTA
CCGAGCATGGAGCGCGTGACCTCTATTCGTAGAAGAGCAAGTGCTGTGCTTCGAGCGACTGTGCGTCCAGTACAAAGTTTAGCAAGATCTTCATCTTGAA
AAACACGATCTATTTCTTCGCCGCCGTCGGTGTTGTCGGCCTTTTCACCTTCTTCAGTCGCCTCTGATGGTGAAGTTTCCACATTTGAGTCTTCCCCTTC
AGCAGAGGTAGCAATAGGAGGTTGGTTTCGACGTAATCGAAGTTTCCGATCGACAGCATGTTGAATAGCTCCATCAAGAGACAAATATTTCAATCCAAGT
CTTCGTGCTAACACTTGAGCTAGTCGAGTCTTACCACTTCCAGGTGGGCCAACAACAGCAATTTTCAAAGCAGGAAACTCGGTAAGAGCAGCAGTGAGTG
CATCTTCAGAATTCCAGTGTGCTGCAGACTCACAGTAAACTTTCTTAGCTCGTACAGGTGTTGCTCCTACGCCAATATACCCCTCTAGCTCCTCATGTAA
TCGTCGAGCGATCTCCAAATCATGAGGTGGAGACATATCAGCTACTTTCGTCTTGGTTGTCTCTGCTGCAATGGCGGTGCTACCATTGACATCAGCCTTT
GTTCTTTTAATAAAAGCACGAGTAAGCGAGTATTTACGTGGGTTATAGCAAACAAGAAGCTGTTTAAGCGACATCTCCCGCTGGTTCGGAGGTTGCAATC
CCCGAATACTTCGCAACGCATCACTTGATGGCGGTAGCTTTTGCAGAAATTCGTTGGTAATTTTTAAGGTTCGATTCAACGGTCTCAGCGTGAAGCGATC
AATTTGCTCAGCCGATTTGGTCTCATCTTGCTCCGGTTCACTGCTTGAACATTTAATTGGAAGTTTCGCGATAGAGTTACGAAGTTCCTTGAGAAAAGTT
GCAAAAACACCAACAGTACTCTCCACTGGTAAAATAATTTCTGCCAGCTGCATGACAGCCTCACGGAATTGTTCAGATGACATCACTTCATTGTCTAAGC
TTGAAGTATTGCCAGATTCACCGACACCCCCCGCACCTTCCAAATCATACTCCCAGTCTCGTTGCGCTGCGGCAATTGCGAGTGCATCAGTTGACAATGG
AAGGACAAGCGCTTTCGCTGCCCGAGCGAAGAATCCGACGTACCCCTCACGACTTAAAGTACAAGAATTCATGGGCTTGGCCAGATCCCAGAGTTGTGTC
AATTCACGAGCTATCAGTGCGTTCGCTTCACGCTCATTTGTGGATTCGTCACCTTCCAGCATGGAGTTCCGGCGATTGAGCCATAGCCGAAGTAGATTTT
CTTTGCCTTCGCCGACGCTGCGTTCCTCCTCGTTCTCGGCGAAGAGGAAATGCCGACGCATCGGAGATTCAAACCGTGTCTCGGCACTTCCAACCTGGAT
CGATCTAATACTCAGGAAGGTAAATTGATCAAATGCGGAAGACAAAAGGTGTTGGTTTCATTATTTTCCTTCCCTCTTCTTTTTTTAGGGTGTCCATTTT
TCCACTTGCTCCTA