Description :
From Genome Similarity Track
Location :
scaffold_81:13081- 22605
Transcript NameFunction/comments
Plaha_PHALS_03235FOG: Transposon-encoded proteins with TYA%2C reverse transcriptase%2C integrase domains in various combinations
Plaha_PHALS_03236atp-binding cassette superfamily
Plaha_PHALS_03237atp-binding cassette superfamily

Sequence
9524 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTAGTGGCTACAATCCGGAGCGCACCATAGTTCCATAAGACGGTTTCCTCATCGTTGA
GCTTCATAGTGTCAGTGCAGTATCTATCACCTAGATCAAGATTCAAGCACTAGATCAAATGCTTAATCATCGGATATAACATCAAGATCAGTTTGACAAA
TTTATAAACGTACATCATCGATGCTGAGCCGCTGAAATTTGTCAATCAGTGCCAGACCGACCGGAATATAGAGAAGAAATCCGATCAAGAATATCACCGT
GCAAAAGATTTGGATGCAGAATGTGCGCTTGGTGCCTAATGTCGACCACTCAAATGAATTAAACAAGTTTGTTGACAGTGACTGTTCATCCGACTCGGAC
GTAGAGTACGATTTCCCTCTGTTAGTCATATGGGCGAGCTTATAGCTCACATATGTCTGCATCAGTCGCTGACTTAGTATATGTACCACAAGGAACAATA
AGAAAACGTACATTAACTACTAACGCGATAGCCTCTAATGCAAAGAACCAGTAAGCCGCATACTTGTGAATTTTTGGGTAACTTGTCGTGCTAAAAAATG
CAAGCACCGGTAGTCCAAAAGCAGATAACACGCCAAATAATCGCACAGCTTGACAATGCTTCCGAGTAAATCTGCCGTATACTTTCTCTACGTTCCCTTG
ACTTTCCATCTCAATAAATTCAACTTGAAATTTGTGATTGACAATCCACGTTACGATAAGAGCGACTGTCACGATCGAAAGCCCTACACAGAACACAATG
TAACCTGGAGAATCTATAAACAATACAACAAACACTTAGCATCTTGCTttgaagatatcaagtcgaaTTTTCAATGTCACCTCTGCCTACGTCTGAGAAA
TAAGGCCATGCTAGTCCACCGAGATAGATATTCTTGGATTTAGCAAGTAACACACATGTAAGAAGTGTTGCAATTGCTACTGTGGTGGCCACGATGGGAG
CAACCCTTGTTCCAATGGCATACACTCCGacattcatttgatgtagaatGGTGCTATCACGGTGGAGCTACACACCAGAAAATGAGAGTTTGGAAAGTGG
GATGACAGCATTCGTAGCATCGGAATTCTGAACATGGACGGATTTTGTGCGCGAGTAATGCTTTAGAATTTGTCGTCACCAAGCAACATATTTAGTGTAA
AACTCGACTGAGACCTCATTTTTGCACAGTGCCATTTTATGTATTTGCGTGATAGTTCCACTATACTAATGTAGCGTCAGTGCCAATAGAGCTAGCCATT
TTATGCTTAAACTTGTCTTTTCCAACACTCTTCAATTCCAATAAATATTAGATAAAACAGAGCGATGCGTGTATTGTTCGCTAGAGAAAACACGCTTTCC
AAAAGTAAATTTCTACAAGTCTGGAATCGCAAAGTTATGCACAGTCAAAAAATTTATATCGAAACTCTTGGAAGGAATGGGACATCATATACCAGTACTT
GACATCCCGAAGGCCCTAATTCGATTGTTAAATTCCTTAAATCGTACCATACTTGAATAAAAGACAAGTCGAGTATAATAGTTTTGACCAGACAGACATC
CTTAGTCTTTACATTACGACCAGTGAAGTATTGTCAATTGTGTCATAGCAGACGTTGCTAATAACACGTCGGAGCCTTTTCAAAGATGTAATAATTGCAA
AAAATAATGGATTTTTAATTTCACTGCCTAATTTTTTCTCTTTCTATCATTTACGTACTTGGTGCATGGTTCAGGTCATAATTTATCATTCAAATTACAA
TGGAGGTAGATAGTATGCTTTCTATGTATATGCAGCAACTAAATTGAGGAAAATTTGACATTTGAAGTAGCTTTTCTTAAAATGTTTTGAGCATGACTAT
CTTCTTAGTTATAGAGTTTTTAGGTGTATAAAATAAATTTATGTATAGACAGAGCGTTGTCGCGAGATTTTACATCCGTACTATCCATATATTATTAACC
CTTATCGTCGCTTAAAATCGATGATACGCATGACAACCAAGGTTACAAGACGCATAAAAAGAAGAAGCCCCATGACGACAGCTAACGAGAAGTTCATGTC
CAAACGACGTGCATTAAACACTTCGTCAATATACAAGGACAAAGGTATATTGGCTACAGCGGGCGGTGCATCTCTAAGCAGTTGGCATCCCAGTGGGTAG
CTCGAAACGTCGATTGTCGCGTTCATAGTTGCAGCCTCTGCAATTTGCTGCAACTGGTTATCGGAACAGTCCCCGAGAACGAGCGCAGTGAGCATTTCAA
ACGTGTAGCGATGTGGCACGAGTTGGGACAACCATTTGTATTCATTCGGAATGCTCGAAGCCGGCGGATTGTAACCCATAAACATGAGAAAGATCGAGTC
AAAGAGTGCACCCCATACTGCAGCAAGCTCAACGGTCGGCATAGCAAACGTAAAGAATTGCCCAAAATATGTCTGGAATAGAATGTGTATAGTCAGAACC
ATCCAATATATTACAGCTacagtgacgtcgccatGTTCAGAGAAGCCTGTCATCGGATAAAACACACTGACAAAGATCGTAGAGGAGACAGCAGCATATG
GTATCTCCACTAAAGATGATGCCACAAAGTACCAGAAAGCGCTGTACGTTTCAGAGTCGCGTTCGCGATAAAATGGTCCACGCTCATTATATGCAAGCGG
TAGAATTTGTACGTAAGAGCTGACGCCTAAAAAGCACGTCGAAAAGAAGATGAGCCCCACGGCACCGTTTGCCCCCTGGTACGTCGAGAAATCAATATTA
CCCGAGTATACGATCCCAAACATAAAGCCAAGAACTAACGCAGTCACCATTCTTGTGAGTGAGTAGAGTGGCGTGCGCCAATAAAGCCGCAAGAACCGGC
GCATCAGCATGATGAATTGTAAAGTATTGCTTGCAGCTCGACGCTGTGCGAATGTCACAGGCGCTAAGCGGTCCGACGGCATGAACACCCCAGGAATAGC
TTGCTTGGCATCCAGAAGCTGCTTAAGGCGACTAGATCGATATGCTGCAGCAAAGTCAAACATTACATCTTGATGTTGGTGCGAGCATTCAGAATTCATT
GAAGAATTCAAAGAGGCATCTATTCGAGAATTTTTCGTCGCAGTATGTGACGACTGTGTCACCGTCGTCGGAATCGTAGAAAAATGCTTGGCTTTCTCAA
AACCAGCTCCGATTGCATCTAGCACCCACGTGGCTGGGTTGTCTCCGCATTTAAAAGTCGGCAAACTGTGTGGTAGAGATAATTGTTGGAAATAGTTAAC
TACCGTCTCACCTTTGTGTCCTAGCTCGCCGAAGTACACAGTTTCGCCTCCCCGTTGCAATAATAAAAGACGGTCGAACAACAGGAATACTTCTGTTGAT
GGTTGATGAATGGTACAAATGACTGTACGCCCTGAATCGGCTACCCTGCGTACGCCATCCATAAGTGACTTAGCCGCGCTTGCATCAAGACCGCTAGTAG
GTTCATCCAGAAAAAGCACGCTCGATTGCGCTACCAGTTCCACTCCTAGCGTCAATCGCTTGAGCTGCTCACAGGTGCTGCCACGAATGAGCTGATCAGC
TACATTGCTAAGTCCGAGCAATTCTAAACATTCCGTGACAATCTCTTCGATCCGCCCTGGTGCCACCTTGTCGCTTTGACGAAGATATGCGGAAAATTGT
AAAGCTTCACGGAAAGTAGATCCATCAGAGTGCACATCTATTTGCTCACAATACCCGGTACATCGACGCACTGCAACTTCGGTGGCATCTACGCCGTTCA
ACAGCACGCGGCCTTGAAAAGAAGGCACGccttttttttgcttgctgCCTATCTTTCCACGTTTGCGACCTGCGAGCACGTCCAATAAGGTTGTTTTTCC
AGCGCCACTAGAGCCCATGAGTGCCGTCATCGTACCGGGTAGTGCGTAGGCGGTGACCCCTTTCAAGAGCTCGCGAGTTTTATTTTCGGTACTTTTACCT
GCATGATGATGATCTTGGGCTCCTCCTACACAACGTTGCCCAGCAAGTTCTTCAGCTTCTGTTGCGGGAACTGTTATTTTGTATCTCAAATCTTGGAAAG
CAATCGTCACGGGTGGCACATTCCATCGAGGCGTTAAGCATACTTCAACATCGTCGATCATTGTTGGGACTCCTTGTGATAAGTAAAATGAGTTGTTCAG
ACCACCATCTTCTTCTACCACGACAATCTCATTGCGATCCGGAAATCCAGCCACGTCGTAAAACTCGTCTCTTTGTGGTGTGGACAATATGGCGTACGAA
TCCTTTTGTTGTCTTGTGATCTTCGGATTCGTAAGCGAACCCGGTAGTTCTGGCGGCAACGCTAGGGAGGATTCATGACTATAGTATTCCAGCATAATGT
ACGATGACCACATGGAAACGATGTACACCATACCAAGAAACACAATACCTAGCATGACCCACTTAGGATCGTCCGGAACCTCATACAACCCGAGAGAATA
AGTTCCGAAAGTCTGattttcaaatttcttgCAGTAATCAATGCCACCATATACGCAGACATCCAATTGACTACTGCGATACTGACTTACTAGAATCCCA
CGTGTAGTCCAAGCAAGTGGATTGCTCCAATAAATCCACCGCATTGCCCACGGAAGCTGCTCACGTGAGACGGCAAAGCCGGCAGAAAGAACCCAGATCA
GAAGTACTAATGTAGACGCTGGTTGAGCCACTAATAACGACGAGCACGCAGCAGAGAGAAAAAAGTATTCGCCAACAAAGACTAAAACAGTTAGAAGCAT
GTACACCAAGAATACAAGAAAGTTTTCCCAGGTGGCAACGAGTCCGCCCATCCAATAGACTAGTGAGCTAAAGATGATGGCTTCTGTAACTGCAAGCGGA
AATTGAGATAAACTCGAAGCCAATACGTAGCTGGATGTGCGATAGAAGTTGGCGCTGCGATGCTTGTAGAATACTTTGCGTGCGTCAAAAAGTGGTGACA
AGATCGCTGATTGACCAAGACCAAGAAACAAAGCACAGGAAAAGGTGACACCTAATGTTAAGTGGACGTCCGCAAGATCCATGCTGTAGTGAACAGATCC
CACCATCAAGCCGACGAGTAGATCCAACAACAATCGACCCACTAAGAAGACTTGGTTACGTACAAATAGTCGAAGTTGACGTTTGACTACTGTCCACGTG
CTTCGTACAAAGCTATGTCGGAACGCAGGCAACTGCAGCAGTGCTTTTTGATCCAAAACAAGCTCTCGATCGCCGTCTTGATGATCCGGTAAACTGTACA
CCTCCGTGCCAAATTCAGCTTTATCCAGCTCCTCGATCATTGCTTCGTACATTGGCGACATGATCCACAAGTCTGCAAACTCATTTGCTTGACGAGGATG
TCGGCGTCTTCCTGGCATAGGTGCACGTGAGTGTTCGTACTGAATCTGCTGCGGAGAGGCTAAGTCGCACAAAAATTCTGTTAGGTCACGCTCTGGAGGA
CAAACAAAGCCCAGAGCCTCAAAGTAAGCCTGGACATGGCATCGAGGGCCATGGTATAATACTTCACCGTCCGCAAGTAGAAGAACGTTATCGAAAAGTG
CTAGAATTTCAGGCGCTGGTTGCTGTAGTGCAATCACAACTGTCTGTAGTTGCTTTTTAGCCATCCGGCGCTGTGCGTTTACTACATCATAAGCAGCTGA
GCTATCAAGCCCCATTGTTATGTCATCCATCATCGCCACTGCATGCGGGCCAAAAGTCATCTCGCCTGTTGTCACTCGCTTTTTTTCTCCTCCAGATACT
CCACGAACGCGCTCATCACCCATTATGGTATCTTGGCACCGTGTTAAACCAAGCTCTCGGGTCACAGAAATAGGGTCTCGCTCTTCGCAAAGATACGTCA
TTGGCAGCGCGAATGGAAATTCTAACGCAGAAGATTTGTATACTGCGCCAACAGGTTTCGCGTCAACACGGACAGCACAACATTCAAATGCAAAGTCTAG
CGTTTCCTTTACCGTCATCATTGGAAGATGTGAGTCTTGTTGAGGAACATACGCGATACATCGCGCAAGTTGTGCCCTTAGGTCGTGATAAGATAGACCG
CTATACGCAATTTCACCATGCAAAGTCATTGTCTTGTTTGACACAGCTAATCGTCCGCTGAGAAGTTTGAGCAAAACCGACTTGCCCGATCCAGAGCGTC
CGAGTATAAGCGTCATGGAGCCTGGCGTGAAGGCTCCAGTCACATTTTTGAGAATCTGACGACGTATGATACTTTTACGAGCTGTGAGGCCAGCAAATAC
TCCACGGACATGGTTTGTGATCGTAGGAAGTTGCTTAGCAGCCAGAGTCTCTCGCCCTGTTTGACCTAAAGCAGCTTGATCTGCTGCAACCGGCGATACA
AAGCCATCCACAGCCAATGATAGATGACGAAAACTAACATGGATTTTCGGAACAGCACCAACCGGACGATGAGGTTTGAAAGGCGAGTCCTGAACACCGT
TTCTTGTTGTTGTTCTACGATTGCGTGAGCCACAAGTGTGGCGTTGATGACGAAGATAGTGCTTTGGATTCGTATCGATAAAAAAAGACTCAAGTATGGG
CATCGGCTCGCTTGACCTACTTGAGATAGACGAGCTGAAATCTGCAGTCGATAATGGTTTTGCCTTGAATGAATTACTAGATTTTCGTTTGTTCATCTGT
TCATTCGGTTGAAAACTTGTCATGATTTCAACAATTCTGGTTTAATCGACTAGACACTATCGAATCTGAATGGAAAATGCACATTTCCAAAACTGTGATT
CCTGTGAGTTGGATTCTTTCATATACAAGTCCCTCTCGTTATTCTGCTTGCACGATCAAAGTTCCTTCATTATGAGTTACCCTCGAACTTCTGTAATTTG
TGTCGTCcatgaaaatgaaaagaGTAGGACAATATTTTTTGGAACCAGCAGTGATGGCACCAGCATTGGTAATACACATATGTAGTACTTTAGATCTACA
AGTATTATTACAATTAATGCTAATAGTAGAAATAAACAAAAGCACGCTACACCGTATTTACATAAGTCATGACTTCAACCTTGCGCTTCGTTGCGTCAAC
TGCCATCGTTTTCTCATCCTGTTCCTCTTTCGCCAATTCTAGCACATATTTGCGGGAATAATATCCCACCATAAATAGCAATAGCAAAGCGCTTCCTGCC
CCGACAAGCAGTAAGATTCCCTCTGTGCTGTGTCTAGATGCGGTAGGGCTGACCAATAGCGCTGCAACGTTCTCTACAGCATGGCCTGAGTAAACCCAAA
TAAATGAAAATGGAAGACCAGTAAGCAATGCTGCTGCAAAATACACGGAAAAACGCACGTCCAGCACACTGAGTCCGTAGTTCTTGATTGCAATAGGGAA
AAACGCCACACGTGTAAGAAATACAATTAAAATCTGACGCTTGCGCAACAAACTCTGAAAACCTTGCAATGCTGGATGGCCACGCGCCATGTAGGAATGT
ACACGATGACGACACATATAGCGCCCAATAACGTACGAGAGTACGGAACCCAAGAGTTTGCCAGTGGTGGCCAGCAGAAGCCCCAGCCACAAGCCAAAGA
TGTAGCCGGCCAGCAATTCGAAGACAGTGGATGGAAAGCAGAGTACCACAAAGCATGTAAAACTACACACGTAAAGCGCAGCTCCCAACGCCTCGTGGAC
TTGCAACCATTGGACTACGAGAGTGAAGTCGTTACTGCGTACAAAGCGAATCACAATCAAGCCAGCCGTCACACCTAAAGCGATAAAGACCAGTACAAAT
AGTGCGCGCTTTAGAAAAGAGAGTTGGGATGTAGAGGTACTTGGAGGTGTGAGCTGCTTCAGCTGCACGGGCTCGTACATGGTGTTACGCTTGAGGTTTT
GCTTGCGGTACTTGACAGTTTAGCATTTCGAGCAACATTGAGATCACTTTTTTGCTGCAACGATTGACGGTACTAGAACAGTATATATAAGCTTGTATAG
ATAATAGAAAAGTGTTACATTGTGAACTATCAAACGTAGCAAAGCAATATAGCGAAGAAATAAACAAGGATGAACATCTTGCTACGATGTTGCAATGAAA
TTTCCTATCCATGATAAACGAATAAAGCGCATCATTTAACCGACTCAGACAAGTAATTCCGTTCAGCAGCATATATCATCTTTAAAAATCGTCTCCACCC
TCGAAAGCTCCATTAAATTTCTTGCCAGTTCCACGTGACGTTTGAGAGTCTTAAGTCTCTACTTTGTTTTCGGTATTCCAACGATTCGTACGACCGCAGT
AGGTTCATGGTGTTTGTTGATTATCTCTCCGAAAAGGCCATCTAAATGCCGTGATACTGTCATGTAAAGGCAAGGACTGTACCAACTCATAAGCGGCTAC
GCCACCAAAGCGGTTTTGCCGAAG