Description :
From Genome Similarity Track
Location :
Scaffold_431:13081- 16133
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_431-fgenesh-gene-0.2Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_431-fgenesh-gene-0.6Transcription initiation factor IIB
Pytar_ATCC12531maker-par_contig_431-fgenesh-gene-0.7Dolichol-phosphate mannosyltransferase subunit 3

Sequence
3052 bases(100 bases per row)
GCAGGGAATGTCGAATGAGCCGCTTGTGACCGGAGAACCCAAGCAGATTGTGCTCGCGCGGCTCGAAGCCACGGGGCTCCAGACCATCACCGGCTTTTCC
TCCGCATACAGCGACACTTTTCCGGACGCGCTGGACGGGATCAGTAAGTGAACGCTAGTGTTTGGAATGATACTATAGAAGCTGACGCTGATACTGGGCC
AGTTTCGCGAAAAGAGTTCAAGTTTTGTATCGATGTGATCAACCAGACGTTGGAGGACTACTTCCCGTGCGCGCCGTGCTACGTCTGCGGATACATCTTT
TGCGTGCTCACGTTTGGCTTGTCCATGCTGCTGCCCGAGCCGTGCACAAAGGAGGTATGTCTGTCGACTCTCTTTCCTTTGCGTGGATATTTCTTGACTG
GAAGTTGAACCGCACAGCTCGAGACCAATGTCGAGGTCGTCATGAAGCGTATTAACAACCGCGAAGAGTTTCTGTACCGTGGTATCGTGTGGAAATTGCA
CCGAACTCCTCGTGCTCACGCGTCGTGGATAGAGATATCCCAGTTGTTGTACGAGTGAGAGAGATGAATCTGATCAGTGTACTGCATCCGATTGTGAATC
AAATGTGGAGGGTCGTGGATTGCCAACACTGCATGCAGGCGTCGCACAAGAACAATAATTTTGGTTGCGTCTATACATCTCTATTCTATTCTATTGGTGT
CAATCGGTGAGGAGGGAGGTACACTGGTAGTGTCCAATGGTGGCAAAATCGACTGGATGCACTGGCACCGGAGACACACGCTGCAGAAACCCAGAAGCAC
ACGTGTGGCCTGTTGTTCCTTTTTCGAACCTGTATAAATACTTACGAAGTTTCCTCGCATACTTACTCTGTCGTGGTTGTCTCTCAGAAAAAACAACACT
GCAGTGTCAGCCGCTGCTCGCTCGCGAGGAAGCACATGCACTGCGGGTCGGCTGATAGTGTAAGGCCGATCCCGTCACTTCCCTGAAGGCTTCCTGAAGG
CTTGTGGGTCGGCTGAACGTGTAAGGCCGACCCTGTTATCCCGTTCTGCAGGCTGGTGGGTCGGCGAATGTGTAAGGCCGACCCCTACTTGGCACGCTTG
GGCTCACGCAAGCAACACTCCTTCAAACAGCGTGACGCGACTCTTGTTGAGCTCCTTGCACACGACCTTCATGTTCTTTTCGCCAATCATCGACACGTCA
CTGATCTCTTGCAGCGACCGCTTCGAGTTTGTGTACGCGGCAACCAAGTAAATGACCGACGCCGCCACCGCGATCGGCGACTTGCCCGACGACAGGCCCA
GCGAGTCGGCCTTTTGCGCGACGTCGTACGCGATTGTCTGCGTCTTGGTGGGCAGACCGAGCCGCGAGCAGAAGCGGCGAACGTAATCTTCCGTCGTAGC
CTGCGCCATCTCAACTTGCAGTGTCTTGGACAGCGTCATGAACGCTTTGCCGATGCGCTTCTTCGACGAGCCGCTCGCAGCTTCAAACTCCTTGAACGAC
CGTGCATTGCCCGTCTGTCGGCACGCGATAAACAGCATCGCCGCGGCCATGCCGTCCTTGTCGGGACCACGCATACTGATCTCTCTCTTGGCGGCGTCGG
CGTAGAGATCCAGGGCGACCTCGACCACACTTTTCGGCAAGTTCATGGCCTCTGCGATGCGTTGGATGCCACGCATCATCTCTTCCATGCGGCGCATCTT
GGTCGACTCGTCCTTGAGCGCGGGGCGGCGATGTGGCTTGCCCGGCTCCCCTTCGGACGCCTTGGAGCCTTTCACTGGGTCCACAAGGAACGTCGTGAGC
GAGGCGCCTTCCAGTCGTGCGTCGACGGCTTCTCCGACCCTGGAATTCGCAGCGGGATCGCCCCCGCGATCGTCGTTAGCAAAGTTTCTCCACTCGGGCG
AGTCATCAACTATTCGCTCACCGAGGACCATACCGCAATCGCGACAGACAATATCGCCTGCGCCAAAGTCGGTCACGACGTCCGCGCTGCCGCAGTCGCT
GCAGCTCTCCGTGTAGCACTCGGCACCCATTTGTTCAGCCGGGGAGAACTGTGGGTGTAGTGGCGAGTGAGTGGAGCGTGGACGCTTGGTGTGTTTATGG
AAAAACAATGACCAGGCTCGGGAGGAGAAATTCGCCGTTGACAGACTCGATGAGAACTCGACGGGAATAGCAGGTGCCGCAGGAGGAGGCAGTGGCAGAA
GATGAGGGGAATGGAGTCCTCTCTCGGCGTCTCTTGTTGCTGTGGCGGCGTGGGTGGCGGGAAGTCCCTTCGCACGCGTCGGTCTGGAATGTGGGTGGGT
TTCCCTTCGAAATAAGATGCAACGGATCTCCCCACCACATCCAATCGCATAAAACCTCACAACCTCACTTTCTGGGTTGAAAGGCCGCCAATTAGATATG
GATTGTGCAGTTACCGTATTTATGGATCTCGCCCAATTTACGGAGGAAGGAATACGCCGATGTGTCGCTGTGCCCAGCGATGGAGGAGCGTGGATATGAG
CAGGCATACGTTCAAGGATCGCCAGATGAAGACAATTAAAAGCCTCTGAGGATCCGCAGGTCTCACATCAGCAGCACTCTTCTCGCACACGCTGGAATCT
TTCATGCTTGCTTCTGACGGCCCCAGCGATCTGCAGCTTCTCGGCCCCAGTTCCTCCACCGCGATCATGATACAACGCAACGAACGCTTGAACCACTCGT
TTACTCTCGTCCACTTTACGATATTGTCTATTACCTGACATCCTCGGGCTCGGTAACCCGTTCTCTTTACCCCTCAAATGTCGAGTCCCTTCTTGCGCAG
GTCTGCCTTGGCTTCAATCACTTGGCGGTCGAGTTCCTTGGCCGCCTCTGGGCAGTCCGTAACAGCCATGACTGACATGGCGATCACTGCGAGCGAGTAC
GCGCCAAACGTCACGAGCGCGTACATGGGCAGCACATACACGACCTGGAGCACGCGCGGATCGGCGACGCTTTGCGAAACGTACTGGATCAGCAGCAGCC
ACAGCGCCAACGCCACGACGAACGTTGAAAGCCACTTCTGGTACTTGAGCAT