Description :
From Genome Similarity Track
Location :
Scaffold_397:130801- 132378
Transcript NameFunction/comments
Aphin_H310_09804Hypothetical protein

Sequence
1577 bases(100 bases per row)
GTTCCCGGTCTATGTCATGGACGGCACTGGCGATCAACGGATGAAGGTGACGATTGTGTCGGTCTCGACACGAACCGAGCACGTCCTGCACGTGCCAGAG
ACCGCTGTGTCCATCCTGGCGTCGGCGGCGAAGTGCGATGTCACGTCAGATGTACTCGTTGGGGACTTGATTGTCCGTTGTCCCATATGTACTGACCACG
TAGAGCTTTAAAGAGTTTCTCGTTGGCCACATTTGCCTTCGAAAAGATGAGCGAACCACCAAGGATACGTTCGTGCTTGGCCAAGTACGCGAGGTATCGA
CGGCATGTACTTGACTTGAGCTTGTTGCTAGACAAGATTCGTGGAGAGGCCCTTCGACGCCACCCACCTTCTGGTATCGGATGTTGCGGAGACAATGCCC
CGCCGAATGGTGGCCGACTTGAGCGAAGTCCTTCGCCAGCTCAGCGACCAGCGATGTGTACGCTGCACTCTCTCCTCGTATGGACGCTTTGAGCTCATGC
GCATACACGCACTCCATTCTAGTTTCAAGAACGGCAGATCTGGAGCAACCAGCAACTGTTTGACGCGATAGTGAACGGGTTCGAGCAGCTGCACCTCCTC
GCCACACACTGCAGTACGAACGTCCATGCAACGCAGGCAACGGCGCCACCCTTAACTAGCACGTGCCAGTGCAACAGGAGGCAGTCGTGGCCAAGTTAGT
GAAGGATGTGGACAAGGTACTCGTCACCAACACAGAAAGATCACTTGTCCATGATGCTAGCGAGGTCACGCGTGCACTGCTAACGCGCATGGATAGTGGA
AGGCTGCGGCGATCGAGCGAACTCGGCGAACCGACTCCGCGCTGCACGAGCACCGTAAGTAGGGGATATGGTATTCTCATGGCCGCTTCATGACGGCACG
TAGAGCGGACATTGGATCAGTTGGAAAGTTTTGCCATGTCCACGCAGCAAACGATCCGAGTACACGTGCATAAACTCAAAATCACAGGCTAATGGGAAGA
TCTGACTGGCGCAGACATTGGATAGCCAAATCCACGATCACTCGACGGCTATGACTGCAATGCGGCAAGACCTGGAGAGCGCATGGAAGATGCGGCAACA
GACGATGGAATTGGAGGCCGAGCGATCTCGGAAGGAGGTGATGCCGAGGTTGGCTATTCCTTTCGCACTTGACGGCTGTGTCGTGCAGTGGAGTGACTTT
CGCATGGACAACAAGCGCCACATGGAACGGATCAAAGATGCGTTTAGCTTGCTCAACGAAGCGCAATCCAGGACGTCCAAGCACGTGACGAATGTCGCTG
TACGACCCCCGCAACATGTCATGCGAAGCGAATGAATGGCTCAAAATATGCACATAGGGCGAAGTCAGCGAGTTAGGTCGTTTTAAGGAGCACGTCGCTC
ACAATGGCCAACTGCTTGCCGAAGTCCGGCAAGCCTACGTTGAGGTAAGTCACCATCCGTTCGTCAAGGATCATGGGCACTGCGTGAAGGAGTTAATGCG
GTAGCTCCTGCCGAAGGTGCATGACATGTACGTCCTTGAAAGGAAGCGGCAAGCCATAGCGGCCGTGCAGACCTTGT