Description :
From Genome Similarity Track
Location :
Scaffold_690:13080- 14157
Transcript NameFunction/comments
Phymu_g11572hypothetical protein PHYSODRAFT_533223

Sequence
1077 bases(100 bases per row)
CGGTTATTTATGAAGATTGCTTGCAGTACGCGCATATTGTTTGCGAAAAACGCACACGGCCACATCGACTTGTTTACCGCGGCGTCACCAAGAAGTGCAA
GAGGAGTGCTGGTCATCAAGGCCCTGGCCGCCCGACGTCAAACTGCCACCCACTCTCTGTAAACTAGACAACATCAATACTTTATTACTACTCTAATGTA
GATCCCTTCCGTTTGTAGTGCGTACCGTCGATTGTGCAACGCTGCTCTGTATCCATCGCTCCATTTGGCTCCCGAGCAATGTGGCCTATTAACGGTCTTC
ATCACATAGTTGCCCCTGTTGTCGCGTTCAAATCGCTTCCAGGAAGCTTCCAACTGCCTGGCACCAATTCGTACTCTCTCATTGATACAATCTACACCAT
TGCCCGTCCAAACTGGGATTAAATGCAAGCAAAGTGGGATGCACTTTCTGGTACATGTGAGATTCGCACTTAGTAAAATGTAAACATTATTGAATCTGGG
ATTATTTGCATTCAAAGAGGGACACGGATTTACGCCCCGTAAGTCATGTTCTTCATTTCCTCCGCAGCATTTACTGAATCACGTGCATGCAGTTCCATCT
TTCTCACTATCGTGGGCGTGATGTACTTGATAGTCGATTTGGCAGCACGCTCCAAGAAACGCATCGATTTCTCCTTAATTGTCAGGGGGATGCCGCTGTC
GTCAGTCATTTCAGTTCGGTCACAGATCTCGCCGCGATACAAAGCAAGATATGCCTTAATGTGCACGTTCATCACGGAGAAGCAACCCTCGATAGGATTG
CACATCGGGGAGTAGGGAGCGAGTCTCAATAGAACCAGGTCGCCTTGTTGTTTCACACGTGCTTCAGTCTGCCGGTGCGCAGGCGCGTTGTCTAAGACAA
CGACGATATTTTTGCCGCTAAAATTGTTCTGGAAAACTGCCGAAGCCTTGACAGTATCATAGATTTCGTCTATAAACGCAGCGTTCTGTTCCATGCGAAT
ACTCCCCCTCTCAAGCTTATAAAGAACAACGCCCATGTCGGAGCTGACTGCACATTGAACCTGTAGGTTCGCGCCCT