Description :
From Genome Similarity Track
Location :
Scaffold_285:1308- 3377
Sequence
2069 bases(100 bases per row)
TTGTACTGTGGTCTTTCCATCAGCGGCCCCTCATCCTCCTATGTCGGGTCCACCTGATGGTCAACTCGGGCGGTAATTGGCTTCATGTGCCAGATTAGCG
ACTCATCATATCTTTGAGAGACCACCGAGACGAATCCTTGCGCTCTTGGCACTTGGTCCTTCGTCAACCTCATACCTATCTTGGTATCTTCATGCAATAT
CAAGGTGTGGAAGCTGACGTTGGTCACCTCTAGAAAAATTGTCAGCGTCCTACCTCTTGGAACATTTTTGTGACCCACCATGCTCCTCTCGCGACAGAAA
GTTTTTCGCTATTCCATGGTAAACCTTTTTAGAGGTATTTTCACATACCTTCCAACAGTTACCTGCGCATACTGACCCATCTACACGTCTGACACTAGGC
TATCAAAATCGTCCTCCGTCCGGATAATCGCACTTAATATTCATTAAAGAAACAGTGTTTTTATCCGCCAGGTCTGACTGGATACCGACTCGAACCATGA
CGTTCATACCCAACATGACGTCTTAGCCTCAAATAGGGCCTACCCGCACATAAAAATGTACTCCAAATTTCCATTCAGATTGATCTTGATGCGAGTGCGA
TCTTCCGTAGTATATACGGATTCTCCAATGCTAATACACTCTTGTCATTCACTTTCGTCAATTTGGCAGCCTAGCTTAGAAGCAAAGGCGGTAATAGGAT
GGATATCTCCGCACCACTATAGAACAACAAGTTCGCGAGATTATTTTGCTGACCTATCTAGAGGCTTTAGCTTGACTAAACCACTTCGTGGGAGTATTGT
ATTCAACACCCCTGAATTCTACCGACGATAAGTCAAACTCCATCTCTGCGTTTCCTCGAGCAAAGTCATTAGACCCATCAAAAGAAGCAATATGGGCCAT
AGTGCATTTTTCAATTTCCGATATATTTTCAATCTTCTTAGATGATGTGCTAATCTCGTTCGTGGGCTGCTTTTCCACAGGGGCAAAGATACAGAAATGA
GAAAGCTCGGCTCATACCATATTCAAACCTGGCGAACGTCCTAATTTATCATCTTCTCGGTCTTTCCGGCAACATTTCGGCATTCTTGGTTGGGTTGTAC
GATTGACGAATCAAGCTGTACAACTTTATCCGGCACTTCCCAACTTCATGAGTCCCCCACGCCCTCGGCACACAAATAAGCAGCGATCCGATGGGTGAGC
CTTCTTCCGACAGAGTTCACAGGCCATTTGATACCAACATCCCAAGTCTCCAGGTTTTCTGAACCAACAATGGAGCGGCCGACGAAGTGCGGGATTACGG
TCCCCCTCCTTCGTGTCAAAGCTGGTTGGCCCCCCTATTAGTTCGGCTCCTCGGAATCCTCATACCTGGGTCCTTCTCCGCTTCCCGTTCCATTCGACAT
ACTTGCATTAAAGATTCTTCGTTTTCCGAGTTGTCCAGGCTGGAGTCCTCAAAGCTCTATTTTTCCAGGGTTGTCCGAACTGTATGCACAGAGCGGCGGT
TTATCTCTCTTGGTCGGTCGAAGGATGGTGGTTCCTTCTGACGAAACGTGATCGATCCAAATTACGTCTTACTTTGTCTTGTATTCGTTAGTTGACGCAC
TCTCAGCACTTCTCCAATTCTTCTACAACAATCAGGCATAGTCAATTGGTCTGCTAGCTCTGGATCGTCCAAATTCTCATATAGTGCTCGACATGTCATG
TCTTTTTGAATCTTGGGCGGTCCGTTTTTAATTTTCAACTTTGCCCTGAGTCCAATCACATTCCAACGGTATAGATAGTCCAACGGGTATTCATCTGACC
TCTTCTCAAATGGTATTACTGGGGGGAAACTGGTTCGACCAAACCGCAGAACGGCATCCGGAATTGTTTTAATAGTTCGTATCGCTAGTTGGCGGTACCA
GTTCTGCGCTGGTTCGGTCAACATTTCTCCAGAAACAAGACACTTTTATCCGTCTGGCTCTTGATCTCTCGTGTATACAGTACTTACGGTAGTCACCCAT
ATGCGTGCTCGGTTCTCGCCTTGATCCCTTCCATGAAACTCCTTGAGACCTGAGATCGCTGAGAGCTTG