Description :
From Genome Similarity Track
Location :
Scaffold_4:130789- 134809
Transcript NameFunction/comments
Phyca_LT153499704Hypothetical protein

Sequence
4020 bases(100 bases per row)
atcgtctcggttgtgctgttgctgtcactgcagttggacgaagagccggaaaagtgtctggatagaagtcaaacgtccaacgatgtttactcttcaacag
cggcagtacacgtctacttcttcaacagcggcaagatgcacatcgtgcagtgctcagatgcatgaagcacgacacttgtcttggacaaagctggagccct
tgcccgccaccgccgcttgacttctctttcgagaggttcattgagcattgcgggcaatacaaaggaacagtgcggtcgtcaactcgggcgaagatctatg
cgcgcgtacgcatgggcgcagctctgctataaaagcagatggagtcttgccctggataggtgagacttgggcagcagctgggcctaagaatacgcgtggt
tcgtggttcggtgtggcagtcttcgacgttcgtgtgaacggaagagattgccagtggtgaacggactgaacgtcggatagtcaaaggaccagcagtctaa
ctaccctatacagcttcggtgctgcagacaatcgattgcatatttatccagcaacgtaatggatccggcagcgtcgtcgtccaggtgcgttcgcactagc
ttccctgttgtgcttagatgctcgcttacgaataccgcttgatacagaatggacgatatctacgagaccatcaaagaaggcagtgttgccgtacgcggac
acttcatggtacagtacagattaatgcagttctattagccacgtagcgtcttctcacttgtcggattgatttcgtagtggcgcgaccgctatgttgtcat
taaaccgggcgagatgatcatccgtcgacgtcgagagggctccatcaaggcgaaggttggtattttaacactttgttttacgatcgcaacgctcaatcat
gatcgttacacagattgacttgcttgatagcaatctgaagctcacgtttcttggggggcaatcgttgtttacgatttccatgcacgggcgagacacggtg
ttcgatttccgctccaccgtgacgcgtgacgaatggatcagtgccattgtaagtgcgcaagaacgacctggttccgaagtggattgcgacgaggatggca
cggagcacctctcggtggatgaaacagacgaccacgaaggacacaaacgcagctcgatgactagtatgggaacggataaaagcgatacgatggaggacga
cagcgaaggttataacgacgcacttctagcgcttcagagtgtgcgagattccgtcatgcagtgtcatttatctatgggggcagcagagagcgatacgtta
attaaccctcgggaccatccgactccagcttttacaaaagcagctccttcactacgacgggttcaaagtgctaagcgaagcgaagaagaactacgacaga
aacggctccgatctctcttggctctgattgaaagcactccgcacggtggtcgcgttgtgctgttacatctcggagttgtggcgtctgcaggaattaatgt
cggtgatatgcttttagccctcggagagaagcagagggacaacccacgacgaggctcgttcacaccacgcactttgaccacacaaaagcacaacgtggct
tcttttgttcgcgatatcctattccatcctatttattccaagcgcgaagaagtcaacacagaagttgtacaaggtctcatcgacttgtttttccctcact
gccgactgcggagattcagcgacgatacggagtatcaacaggttcaaccaattcctcacaacgcatccagagtcaagagtgagaatgatgcagatgtaga
cccttccagtatatccgtaccaactccaactactaacccacagcggccccaaagaagaaaacgacgcaatcactcgttcccgaacttaggagggatctct
caacttgccaagagcaaaggcttattgccaacttcaaaagacgacaatgacagatctatcagctcgaggaaactggaggaaggaggtcaacgactgcggg
ataatttgtcagttttgtttgctccaatgacaccatctccagtcctaggaggtggaagagatccccacattccgctgttaagtccaagcactccattcac
ttccagcgcctcagatgaactcgatttaatatgtgaagatatcccgctaccagttcctcttcgaagtatgctgtgggaaatgtcgtgttccgaaatggct
gaacaactcacgatcttccaccactcgcaactcacaaatgtacgtccgtgggagtttctgcatcacccgaaacaagctgctaaggagctgacggaccatt
tcaaccgcttagtagcgtacttcgtttggtctgtactggttgaggattcacccaaggagcgagctgaggtgattgaagatattatctcaattgctatggc
agcaagcgcaccacctctgaataacttccacctggtcatggcatgtgtcggttgtcttggtgatacgccgttgatgtcgtcccgaatgccaacgacgtgg
aaaaaagttcgtgcaaagtacaaaacgcgtcttggagagctgcggagactgtgtgatcacactggaggcttcgagaacttacgaaggaagcaaagcgctg
aaagcgctcgcccagtgctatccagtgatgtctccacttcttcgatcatcccgttcattggtgttatcggtgtaatgctcgagcgtctgcgttctactag
ctacttcactgccaagaaaatgctggatgtggagaagctggagcgacagtatatggtactcaatgtccttgaaaacgctctactcaagcctgcaccccga
ccatctcgaggcccacaacgtgggaagtcagcgccgagtgaaactgcagcggaaatgaccacccgtttgcaacagttcttcaaagtactcaatatggact
tctccacctcgcgtttccaccagctacgctcgcagcagattctagcgaatgaaactagcgccacaagttcagcttcagcgtctttcgggcttggaaccac
cttgaacggaagcaacagaggcggcgtgccagtgaaccttaccgcgagcatgtcaatccacagctcactcggccctagtgaggactccggtttggcattt
gtatcgtttcgagatatctgcgttctgcttgtttcagttccggagatgcgagaacggatgcaaatggctctcgaggcgctttttgtagatggccgtcaac
cagctacccagttcctgcgcaagttttggctcgatttcaagcagaacgtgtggatttccggtgtcggccccaccttgcagagtgtacgtctttgcgtctc
ggctctttatcaggaggtcatgacgtacaagatcacagagctcatgcagatcactggactggacgagaactcgagcgagttgcacgacgtggtatacgcc
aagctcgtgatggtgacagtgcagcccatttacctcaaaatcgtctctaaagtgaagcggaacttcgtcaaggaggatgcacacgcatccactcgactac
tacagagcaccccacaggttgtcgtggatagtagcagacctacaatactgtggagcagttgcagttgtagctctccggttgagctgttggatctcgtctg
tcaattagttgcactgccacgggctagtaccacgactgcggccgtagcagcaactgatcatcagcttgcagcagtggagctgcttggggcgctgcaacac
caagctcgacacactttcctcgctacaaaccccgtgagtagcttgtacctgatgaagcacatcctggaccccaagtatctgcctctcgcacgacgtcaag
ctctcgaggtgttcatcgctgcagtcacatggctgcgaaaggagaaggacggatgaatcttccacaaaaggccagagcgaacgacagccttcgccatgga
tcattcggtggcgctctggtacattacagtaccttataaggacgtcgactccgctaaaattgcggtgagatgttcagaatatattatatcgcgccagctc
cccagctctagtaacttgac