Description :
From Genome Similarity Track
Location :
Scaffold_11:130761- 133817
Transcript NameFunction/comments
g4048.t1hypothetical protein

Sequence
3056 bases(100 bases per row)
CAAAGCACACGCGGAACGCACGCACCTCGATCGCCTGCAACGTCACAGACGTGCCTTTCACAGGCAAAGACCGAGGCGACCAGCCGTACGCTTCGTCCGT
CGTCTTCCACTCCAGTCCGCCGATCTCCTCACCCTCCACCGACAGCTCCTTCGTGCCAGTCAAAGTCAGCTCCGTCACCTCCGACACCACCGAGTTCTTC
ACCGAGAACAACGACGAGAAGTCCACCGTCGCCGGCTGCGACAGCGTCGAGTGCTCCTCCACTGCGTACAAGTGCGACAGACGCACCAGCAGACACTGCT
TCGACAGCTCCTGCAGCGTCGTGAGACCCACGTTCGGAGGGAACTCACCCACTGCTAGCCACGGCACCTTCGCCTCCACTCCAGATGCCACGGGTTTGCG
GAACACCGCCAGAGGACGGAAGAACTGCGACTCCATCTTCGACCGCAGACTGCGCATGCCGTCCTCCGCAGAGTCCACGTTGACGAAGAAGTTGCCGCGC
ACCGCCAGACCCTTCGTCACCAGCTTCTTGTTCGCCGAGTCGTACACGGCCTCCGTCTCGTTCAGGTGCTCGCCCACGCCCTTGTCGTCATCCGCCAGCA
AACGTCGGTGCACCATCACCTCCACCTGACCGTCAACCAGACTCGCCGCACCCTGCGCACGGTCCGTCACCACGTTCAGCTGCCGCTTCGCGTCCTTAAT
GTACGCTCCCGTCGTGATGGGGAAGTAGTTGGCCGCCACCGTCTCCTGATTGTCGTGCAGCGTCAGGTTCCACGTGTCGCGGTGGTTGCGCACGCGCTTC
ATGAACTCCAGACCGTTCGAGTCCGTGTACAGCGTGCTGTCGGACGCGATGCTGTTGCCCGCGTCGAAGCGTACGATGACCTCCTTGCCCTTCTTATCGT
CGATGGGGACCGGCCCAACGGTCCACTCGATCTCCAGGAACTCGTCATCGTCGTTCACACGGTACTCCAGTGTGACCCACTTGCCGATTTTGAACGCCAC
GCGTGGCACGCTACTCAGGCGGTTACTACCAGAAACACCACTCGTCTGCAGCTCCACCATCGTCACGTCCGGCACCGCAGACGCTGCCGTGCCGCTACCG
CCAGTCACGGGGTACGTCTGGTTCGAGTCGGGACGGAACACGTACGCGCCAGACTTGTGTCCGTCGCCTTGGAATGCCTGGTAGTACGCCACGTCCAGCG
ATAGCGAGATCTGGATGTTCTTCTTCTTGTTGGCCAACTTCGTGATGGACCCCGTCTTCTTGCTCACCTCGGCGCGCAGCAGGTGGTTCTCCAGCACAAC
AACGTCCTCATCGTCGCTGTACTTGTCGTCGTCGAGACTACCAGCACCCTCGTTTCCACGCTCATATTCGACACCTCCTCGAACGTTGCTGTCGTCGCTG
GCATCCTTCTGCTTCACCAGGAATCGAGCCGTGCTCAACGGCTTCAGCTCCACACTGAATACGAACGAGTTCGGAGCCACAGACGTCTCCGGGTGCACTG
GCACAGCCACGTACACGTTCTGCTCGCGGAGTCTCGCATCCCCCGACAAAAGCTGCGCCTCCGCCGACCTGTGCGTGATCGGAACTGACAGCGTTTGCAC
ACTGGTACGCGCCAAGGCGTTGTGCACCAGCACCTCAAAGTCAGTGTTCTGCGTGGACACATCACAGACGCTCGTGTTGGCCAACAGACAGAAGTGGTAT
GGCTCCTTCTCGCCGATCACGAAGAGCACCTCGTTCAGTTCCTTCTCCGCCTGACTGATGCCGTCGTTCAGCCGCAGCGCGTAGTCGTCGGCAACGCTTT
GTTTCTCCGTGCCGGAGAGACCATCGTGGTGCTGCACGAGACCAACAGCCCGTTGTAGTGCCACCAACTCGCTCGAGTGGTGGCTTTGGTACACGGCGTC
CAATTGACGCACCTGCTGCAGGAGAGTGTTGGCAACGCGAGCGAACCGCTTCAAGGTTGGCCGACTCGTGAAGAATCCCGACCAGTAGTCATCTTGGTCG
GACGCGTACGGCATGAAGTCGTCCGTCTTGACGCTCCAAGTTAAACCTTCTGCATGCTTCACGTCCGTGTAGTACGACAGGTTCGAGTAGAGCACGTTGA
CTCGCGCGTCCTGGTTGACGTAGTGGATGAGTTTGTCCATATTCTTGAACCAGTGTCTCGAGTTGTCATACTGGAAGTCACAGCCCATGGGGATGAAGAC
ATGGTTGCCCTTGGACGCGCCACCACGCATCTTGGCGTTATTGACGAACTGCTCCACTTCATCGCAGACATCATAGTCGTGCAGGTCTGCATCATCCTGA
ATCTCATTGCGAGTGTCACCGTACTCGAATTTGCCAGGAGGGCAGTACGTGTCGATGATCTCACCCGTGAATACCTGCGACTCCTTACCGCGAGACTTGC
TCGGACGCCAAATGAACTCCAGATCCTTGTTCTTCTTCCTCAGGCCGTAGTCCTGGTAGTCCATGCGCGCGAAGTACAGAGCGTCAAAGCCCACGCCCTG
CGACAACAACGAGCCCTGTGTGGCCGAGTGGCCGAACGGATCGATCTGCCACCCGATGCGCGGACTGATGCCGAACTCATCCATGAGCAGCTGGTGGCCG
TACGCCGTCTGGTCCACCATGGCGATGTAGTGCGGCGTGGCCTCGTCGTGCATGCACCAGCCGCCGTTGACCGTGAGGTCCAGCCGTCCTTCCTTCACAA
GCTGCTTGACGACACCTTGCACCTCGGAGCCCTGCTCGTGCCACCAGCGCTGGAAGAAGGACTGCTCCACGAACATGAACTGGCGGTCTGGGTTGCGCAC
GAGTTCCTCCACGGCCGTGTCCAGGATGTACTGCACCTTCTCCATGTAGTACTGGTCCACCCCCATCAGCCAGCCCCTAGCGGCAACAGAGTCAACATGT
TAGTATAGATAATATAGTTTTGCAATATGCTGGTGTGGGCGTACGGGTCGTCGTGGGAGTGCGCGATGAGGTGCACATTGAGTTTGTTGGGGTCGATTTG
GCTGGAGGTGTTGTACACGCCGTCGCTGGGTGGCGTCCACTTGCTCGGGTCGCAGG