Description :
From Genome Similarity Track
Location :
Scaffold_415:13076- 22149
Transcript NameFunction/comments
Phyta_totarag8088putative RNA helicase
Phyta_totarag8089conserved hypothetical protein
Phyta_totarag8090hypothetical protein PHYSODRAFT_538135
Phyta_totarag8091hypothetical protein

Sequence
9073 bases(100 bases per row)
TTTTATTGCAGTCATTAGATCGGGAGTGGGCGGCGCTGTATCCTCGCCAGTCCACACGGTTTGCAAACCCTGGAGCACCTCCTCTATCCGATAGTCACCA
CTATGGAGTGGATATGTAACGCATGGAACGTTTACCAGCGACCGCGGCCCCCGCCGTAgccaccacggccacgaccaccaccgccaccacgaccCACTAG
GTCGCGCAGTTCACGGGGCACCTCCTGTTCAGCCTCCTCCATGATCTTGACCAGGGGTCCAGCCAGCCggccgttgttgctggctgtgaagaaggagatg
gacGTACCCTTGTTGCCAGCACGGGCCGTACGACCGATACGGTGAATGTAGTCTTCGATGTTTTTCGGCATGTCGAAGTTCACCACGTAGCGAATATCCT
TGATATCCAGACCACGGGACGCCACGTCCGTAGCGACCAGAATCTGggtcttgccgtccttgaACTCACGCAGCACGTAGTCACGCTCTTCCTGCGACTT
GTTACCGTGGATGGCCTTGCACAAGTAGCGGGTGTTGCGCAGGTTACGGCAGAGCTCATCGGCACCGCGCTTTGTCTCGCAGAAAATGATGATACGACCG
CCGTCGTAAATGTCGCGCAGGTGGTCCTGCAGCGCAGAGTACTTCTGGTGGTCGTCCATGACCTCCACGATCTGCTTAATCTTCTTGTTCGCGGTCAGGT
CCAGCGAGCCCACCGTCACCTGAATGAAGTCCGTCAGGAAGTCGTTCGCAAGCGACACAATCTCCTTAGGCCACGTCGCTGACCACATCAGCGTCTGGCG
GTCAGGGCGGATTTGGCTCACAATCTTGCGCAGCTGGGGCTCAAAACCCATATCAAGCATGCGATCAGCCTCATCGAGCACCAAGTAGGTCACACGGCGC
AGGTTCGTCTTACCCATGCTCAGCATATCAATCATACGACCGGGCGTGCAAATGCAGATCTCCACGCCGCGACGAAGATCAGCAATCTGACCACCCTTAG
GGACACCACCGTACACGCACGtgttcttgatcttggagcTCGCACCGAACTTGTTGCATTCCGACTGAATCTGCACAGCCAGCTCACGCGTCGGCGCAAT
GATCAGCACAATAGGACCGTCTCCAGGTTGCAGGTAAGGCTACATAAGTCATCAAACACAACACGGTAAGCGTTAGTGCACTCCATCATACCACAAGGCA
CGCAACGTTGCACGAGAAAGCAAACACAAGCGAGCGCCGAGGGATTTGAGGTGTTCGCATGCTGCTTTTTCTTCTGGCCATCGCCCACAACGCACCAATG
CAGTTATCGCACCGATCGATTGTCAGGAGGACGCCAGCGAGAGAAGAAAAAGGCACCCGTACTCAGCCAGCTGAACGTGTGTCGGTCGTGCCGGACCAAC
TATCGAAATGGTCGGTGGGTATTCTCTTTTGTTCAAATACGTGTTGCCACGCACAATTCAGCAAAAAGAGAAACTGTCTCCACCAACTTGACCGGCACCC
CAACACCACAAACTGCGATTCGAATCAACTGAAGTGACGAGTAGCACGCAAAAGCCGTTCAATGAGAAACGAACAACTCGCTCCTCACAAACGCGCATCC
ACGTGGATCGACCACACTCTGAAGATCGTTTCAACCCCTCACGCCTCACGCGTGTGTGTCCCGTTCAGCGCATCCAAGTGCGTGAACGACCGTCGTGTGC
TAAACACAACTTTGCTATCACTCTTTTCCATCAGCGCACTAGCGCCACGGAAGAtgcgtccagcagcgaccaaAAGCCTCTGTATAGAGTCTGCTGCAAA
CTACGAACCTGTGCGTTTATGTGCACGATCGCGGGCAGCAAGAAagccagcgtcttgcccgaGCCCGTCGCTGAAATGCCGACCATATCGCGCCCAGAAA
GGGCCATGGGCCATCCCTGGCACTGGATGGGCGTGGGCTTGTCGAAGCCCAGACGCACcacttcctccagcacgtacTCGGGGAACGACGCCTCCTCGAA
CGACAGGACGCACTTGGGCACGCCCTTGCCGGACACAATGATCTGGTTGTCGCGTTTCCACTTATTGTACTCCTCCTCCGAGCGCTTGGTTACGTCCGGG
TGCTCGTAGTAgaagttcttctcgaacACGGGCAACTTCGACATGTCCCACTGGATGTGCGTGTCCAGGTTGGAGCCGAGGTCGCTGCCGCCTCCAAAtc
ctccgccgccaccgccacggccacctccacggccaccgcctccatagccaccaccaccgccgtagccaccgccaccaccgccgtAGCCGCCGCCACGGGA
GCCGCCAtagccaccgccgcctccgccgtAGTCACGACGCGAGGAAGAGTCGCCGTATCggtcaccgccgccgccgtaCATGAtcaagagtgatggtctt
tCTAGACTGGGTTTTCACTTGCGTGCTACCGGTCGTTTCGGCGAATGGGCAAGATGCTGGCGGCTTGGGCGACAGGGGCAGAGAGCGATCGCTTTAAGTA
GGGAGCGTTTACCAGACGGGTTTTGGTTGGCTGCCCGCGGGCGGGATTTCCGGCAATCAGATGTCGCAGCTCGCACCATTCGTGGAAATTCGCCAGGATC
CGCTAGCGATTGGACGAAATAAGACGAATCTTTGGATTTACGGTTGGCCGTTAATGGCTCAAGATgaaagttgaagtgcattCAGCAGACGAACGTGGAA
GCATACAATGGAGTGAGTGCATGAGCCCGTTGTATTGTACGCTCGAAGCGCAGAAAACGGTAGGACGGGGTCCTTGCCTCGCTCCGAAAGTTCGGTGGTT
GATCTGGGGGAACAGGTCCCCGCTCTCAGCCCTCTACGCTAGGATGGTGCGCTCGTACGAGGCGAACTGCTGGTTGGCCTCCGAGATGCTCACCTCGATC
TTGCTCACACCGCGATCCTGCAaacgaaaaaaaaaacaattgaGCAAACAAGCATTGTAAAAAATTGGCGGTGCACCTATTCCTTACCAGGAGCGCAACG
AGCGTGAAAGCGTCCACGAGTTGATTGCTCTAATCGCAGTAAAAGCCATAATAGGAGTTAGCAACAAAGTAGGCGGCCCGCTATATAATAAAAATCACAG
TCCACGTACGATGTAAATGGCGAGCTCCTCCGCCGACGAGTGCACAatcggcagcagcgagcagtcTGACTTCGGGAAGCTGGAGACAATGTTGCAAGCA
AGCACATTTTTTAGATTCACTGCCACAATACATTTATGCATGCAGCACACATGGCTACAAACCTGAACTCCGCCATGTCCTCCGTGATAATGTGTACATT
CCTGCCGTCAAAGGAAATCTGTGGTACAACCAACCGAATCAGCATCCAACGCAACAGAAAGCACCAAACATACTCTGCAACGCCAGCAATCGCCGTAACT
TTGCGACCCCTTACCTTCAGGGCATCGCTGTTCATGGGCACAAGGAATGATTCGTTCAGGTCCTTGCAGATGACCCGCgagatcttcttgatctcaCCAA
AGTCCAGAACGTAGCCATCCGGGCCAACCTGCCCGGTGATCGTGACGGCCAAACGGTAGTTATGtccgtgcagcttctcccGGAATCCCTTCAGTGGgga
cacacacacacagccAAACGAAAATCACAGTCAGACGCTCCTCTCTAATCCAGTTTGCGCTCTCTATCCACAATATCCAAAACCAAATCTGCAGCCATAC
CTTGTAAGCAATAAAGTGCGCCGCGTTGAACTTCATGTAGTCCTTGGACACGTGCACCTTGAACACTTCATTGTGGCCGCTGCTCATGGGGTTGGGCGTG
GGCGTGGGGGCCGCCATAGGCACAGCAGTAGGAACTGTGAACGCTGTAGGGGCACcagtaacagcagcagcagccgtctGCACGTCCGTATTCACCGACT
GTTGCACAGTTCGGATGGGCGTCAAGGAGCCGCTGGTCGGCGcagaaggcgacgacgcatTGCCCCGGAACGGCTGAATCTGCGTCTTAACATCTTCCGG
AGTCTTGACACAGCCACGCAGGTGCGACGCCCAGCGGTCCACATTACGCGACGAGATTTCCTTGTCGCAGTAGCAGCACTTGACGACTCCCTCGGAGACG
CCGCGCACCACGTACATCTTGACGATAGCCTTCTGGTCCGTAGTGATTTCCTTGCCCATGTTTAATCCCGTGGAGTTGTGTTTCCGTCTCTTGCTTTCTG
GCGTGGCTGCGATTGCCTGGGCTTCCTGCTCAGCAATCCTtttctgctcctcctcgtccactGACAGCATGAGCcagcggtggtggcggtgtgGATGGTG
CGGACTGCTCTCCCTCGTTGAAAATCAGCGTAGAGAGGATATGATTGGTGGAAACGAACGCATGGTGTATGTTACACAGTTTCATTGATCGTAAGGAGTC
AAGGTATTATGCATGTAAAAGTATCCATAACGTTTTAGGACTCCACAGGCTTGAAAGGCGAAACAACGACACAAGCTGATAAGCGAAAATATATAACGAT
GCATGCCAGCAGCTACGCGTTTTCACGCACTCTTTGCGGCacgctggtggcggcgctcTATTGGTCGGAGACAGCACGCGGCACAACACTCAGGAAGAAG
TTCATGCTCacgccgagcagcagaccaaCCTTTTGCTTTCGAGGAACGGAGCGgtcgagaagctggtgggGAGGGGGGAAACACAGTCACGTTAGTTACA
AGCAGACAGCTTTCCATGAAAGTATAGTGCAGAACTCACCATCAGAAGCATAAATACACCAAGCAGGAGGCCCATCAAGAACCCCCATAGAAATTCAGTG
CCGGTGCCTTCATTATCTGCAGCCAGGATGGAATTGTTCATGCCGTTCATGTCGATCTGCGTGTCCATCGCAATACGCGCCGTTGGCACAACATTAAGTG
CTGAAAAATAATAAATCTGGCTGTCAGTCACAGGCTTAACAAACCCCTTCATCATTGCACACGTTCGTACCGAACTCGGATTGTGGTCCCTGAGACGCCA
TCCACTCCTCTTCCAGTCGATATATCCGGTCCTCACTACTCTCTCCAGGAACGCGTTCCGCCTGGCTGATGTACACCGAGAGCTGCGGATAGAAATACAG
ACGCAGAGCCTGGATCTCCTCCCGACTGAGTCGGTCACGGAGTCTGTCAAAGCCTCTCCTAGTGGACGGGTCATCTCTCTCCTCAGGTTCGCTATCACTA
GCTGCCACCTGTAGCATGATATGAACGTTTCATCAACCAGTTAAACACCCACAAAACGTCTCCACCAAAATAGACACAAGAATCGTCGCACCTGGTTGAC
GACAGCCTTCGGGGGAGCCGAGCTGATGGCGCAGTGGACAAAGTCCTCGTTCTTGACCTTGCAGCTCTCCAGCGTGACCTTGTCGTCCGACAGCATCTTT
CCCTGATGGATAAGACGCAGGAACTTGCCCTCAGCGttggctttcttcttcacgagctccttgagctccgccacaCTCGCCGACGGTGCGATCTCCACGC
GCAGCGGCTTCTCGCTGAGCGTCTTGACCTTCAGCACGATATTGccattgttgttgtcttcACTGATCGTGATGCCCACGGAATCCTCCGACAACtaaaa
aaataataaaatGGAGTAAAATAAAATCAGAAGCCAACATTTTATCTTCAACATGCAAGCAGAGCACCGAATCGCAGCGGACGCCTACCAGTGGCTTCTC
CTCCGTGATGTTCTCGATGTGCTCTGGTTCCATCATGCTGCCTGACTCGATCTATAGGCGCTCGCACGCCTTCCACGACCGCTCAGCGCCGCCGACCTCT
GCGCTGCTAATTGATCTGTGCGGTTATTCTCACTCATCGCTTTTTTACGATCAGCCGCGGCTAGGGATGTGCGAGCCAGTTGGATCTCTGCTCTATTATT
GGCACAAAATAATTGTCCTTTTCAACCAATCCATCACGCCGGCGCTATTGTGATACTTCACCGAATTCAAATCTCACGCGTGTCAATGGCGTCCAAGACG
CAGGATGCGGCCCCTCGTGCTGCCTCTGACAGCGCGTTGAAGACGTCCTGGACTCGTGAAAATTCGTCTCAGACCGACGCCGTACAGGTGGCTGTGCGAG
TGCGGCCGCTGATCCCCAGCGAGGCGTCACTAGGCTCGGAAACGTGtgtggacgtggtggatgcCAGTGTCATATTGGCCGAGAAACAATTCGACTTTGA
TGCAGCATTTCCAGCGACGGCACAGCAGGTTCAGATCCTGCACTTTACTTTATTATAGATTATAGTATATTGTGCTAACGTTGCGCTATCTGTTGCACTG
GATTTGTTGCAGGAGGGCGTGTATACTACGTTGGTCAAGCCTTTGATCGACGAGTTCTTCGATGGCTACAATGCAACAGTGTTTGCCTATGGACAGACGG
GATCTGGCAAGACGTGAGTGGTGCTTGGTGGTTATTTGGAGGTTGATTGGGTCTGACTGACTTGATATTTGTGGCTGTTGATGCGAAGATACACTATGGG
CAACGAGTTCGCGTCAAGTGTAGCTCCAACTGAGCGCGGCGTTATTCCGCGCGTGATACAACATGTAAGAAGTGCACTTGATTGTGGTATGTGGGTGTCT
GTGTGTTGGTTCTTACGAGCTCATTATGTACGTGCAGATTTTTGAACGAGTCAATGCATCGGCTAATCCGCAGCATTTTGTGATCAAGCTATCGTACTTG
GAGGTGTGCGGCTTATATTGAGGTTATTGTGGGGTGAGGTGTCGGTTGCTGTACTAATCCGTTCTCGTTGCAGATTCTGAACGAAGAAATTCATGATCTG
CTTGCAAAATCGTCACCTGATACGCCACTGCCGCCCAGCACGGGGCTATCTGTACGTGGTGATGGAGATCGTGGAATTGTTATTACTGGGTTAAGCGAAC
ACGTTGTGAATTCGACTGACCAAGCTGGAGATTTTTTGCGCTCTGGGGCATTAGTCCGTGCCACAGCTTCGACAAGCATGAACGTTCAATCTAGCCGCTC
ACATGCCATTTGTACTCTCGTCATGGAGCATCATGAAGTCAATGCTGTGGAAGGAGGCACGGAAACGCGATTTTCTAAGTTTCACCTGGTGGATTTGGCT
GGCTCAGAACGCGTCCGGCGCACTAACTCGGAAGGAGCACGTTTTAAGGAGGGTGTCAACATCAATCGCGGGTTGCTTGCGCTCGGAAACGTTATCAATG
CGCTATGCGAGCGTAGTCGTACTAACTCACTGACAGCCCATATACCCTATCGAGACTCGAAGCTGACACGTCTGCTCCAGGACAGTCTTGGTGGAAATAG
CAAGACGCTGATGATCGCGTGCATCAGTCCCGCCGACGTCAATTACGACGAGACCTCAAATACACTACGGTATGCGTTTCGAACACGGAATATTGAGAAC
CAGGCCGTGATTAACAAGGAACGAAGTGCCGGAAACAACGTGGTATATCTGAAACGACAGTTGGAAATTATGCAGTTGCAACTCCTAGAGCAAACTCGAG
GCATAGCACACAGACCAGTCAGAATTGATGCTCATAACTCTTGCTCAGACACGAGTACTCTACTGGAGGAGGAAAATCGCAAGCTGAaagaagaacttct
tctaGCAAACAGGGCCAAGGGCAAGTGGAAAAAGATTGCGGATGAGCTTATGGACAAGAGCACAAGAGTGAATGGAGAGACGAAGATGGCTTTAAGCAAA
CCGATTCAGATGTCGACGCCTATTAAAAAGCGCACAGCAGGAGTTGGCGACCAAAAGAATAAAGTCAACCAAGGAAACAACAGCGGTCATGTGTcgcgac
tggagcagcttaGGAAGTTTCAAAACCAGAAATTCAAAGAGTTGCACACCAAGGAAAGCACAGCTATGAAGCGGAAAACTGATGGCCCTATGGCAGCGAG
GAAGCGCAATCGGCCGTTAATGTCGCCACCATCTAACGCTTCAGATATGGGAAGAAAAGGTTTGAGCGCACGAAGAATTTCGGTACTCTTTTCACAAGGT
AACAAGGGCAAGGTTGGTGAATTTGATGTTCAATCAATGGAAGCCATCCCaaagctgttgcagcaggtggtggcATCCCAAGAGGCGATTTATGGTGCGA
AGGAGGCAGTCCGGGTGAATGTTGCTGACAGGAAGGCTTTGGCGCTTGAGATTTCGCGATTGGAGGCTTTGCCCTCGGCAGAAAATACCGACAAGCTGGC
CACGTTGCAAGATGACCTTTGCAATAAGACTGCTAACatccgccttctccagcagaagttgtcgacggtCGAGAAAAATGTGTCGCTGCCGCCTGGGCTT
TTTCCTGCACGATTAGATATATGTCACGATCTAATTCGGCATCTCATTGAAACGCTGGTGGGAAGTAAGGAGGAGTGCATGGCCCTTTCAAACTGCCGTA
TtgagctggatgctgcaAATGAGAAAATAATGGTTGATCACGAATCCCATAGCAAGAAAATACATAAGCTAGAGACCAAGCTTGAGGGAGTGCTAACGGA
GTTACGGGTTCTGGagaagcaagcaacaaaGAAGAAGGCATCTAAGAAACGGAAAACACGTGAGTCATATGAAACAATGGAGACGTTATTCAGCAGTAgc
ggcgatgaagaggacaacAGCGAAGCTGACCCGGACTATGTAGATGAGGACGATTGTCGAAACAACAAGAGAAAACGAGGCAACAGCACACCGGCGTCGA
AAACTTTGAAAAATGTGGACGTTATGGACGAGatcgatgagctgctggaaatcAGTGcagcttcctgctgctcctgtcACGGGAAATGTGCAACGAAGTC
ATGTGCTTGCAAATCGCAGAACCGTGTCTGTGGCGCTGAATGTCTGTGCAATTCAAGCAAATGCCGAAACCGAAAAAGTGGTGATACCCTAGGTGCCAGT
CTTCTTGAAAATGAGGAAGGTACTGATTCGACTAGTAGAGTTCTTGCTCCCTCGACTCCAAAAAGGACAGCAAGTGTCTTGAGTGTGGCTGGAGCTTTTG
TCCCGGATAAACCCACGAAGACAGCACCTGTACATGAGGTGACAGTCCCACTTACGATTGACTTGATGTCGCC