Description :
From Genome Similarity Track
Location :
Scaffold_6:1307437- 1315501
Transcript NameFunction/comments
Physo_336662Hypothetical protein

Sequence
8064 bases(100 bases per row)
CCAAATAATGTTTTTGGGTTAAAATGATAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGC
TGGTTGGCAAAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGTAAGAGATGCTGCTCTTAGCCAATAGGAATCCAAAGTCTCTATGGACCACCCGTC
GTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTTTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTATCTGTTAGAGTTACAAGT
GACTGTAGCCACTTGTGCGTGTTACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTC
AATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCT
CAATACCATGAGCGCCAGCAGGCAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACTCAGTCGGAGATTGTTCTCGAAGGTTCCTCTGTAG
TCAACGACGCCGTTGACTATGGGAGTGACGACGAAGAGATGGAAGAGGGCGAGGCCTCTTCCAACAAGCGCAAGGAGTCTATCGACAGTGATAGTCTCGA
CCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGCGAAACTCCGCTCTCCGCTGCT
GGGGCTTTAAGCTCCCCGCGTGAGGTGTCGTCTTCAAGTTTTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGACGCCGTCTGCGTCAGAGATCGCAG
ACCGTGTGGGCAACACCGTGCCTCCAAATGAAATTCCGCTGTACGTATGCAGCGGGATCCACGATGATGCTGTGGCGGAGGAGTAGCACTTTGATCCGTT
AACGAATCAAAGGCGCGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTAAGTGGCAG
GCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAAGAAGAAGCCGGCTGCTTACCGTGAGCGGGTTAAGCATGCCCGTGAGCGCTTCGAGACAT
TCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCGTGCGCTGTGCCCGAAGGCCATCAGTGCACGTTGTGTCTTCC
GGGTGCGGTGCGCTTGAGCGACCGCGACCTAAACCGGTACACGACGATTCGTGTACCTGAGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGGCACGCGAG
GAACGCGACGATCGTGGGACCTCGGGCGAGTAGGGGACCACAGCGCTCGCACTACCTTCGTGTCGGCAGTGTGTGGTGAGCTTCGTATGCCCTCACCATT
TCCGGAACGTCCTGCAGGAGGACGTCCCGTGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGCCGGTTCG
TTTTCGGGATACTATGGTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGCAGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGCCCCGGGT
ATGGTCAACCAGGGGTTGACCTTGGCCCGACGCTCGAGGAGCGGGTCGCTGCTGTGGAACAGCATCAGATCCGGGAGTTCGCCGCTCTGATGCAGGCGGT
GGCGATCCTGAGGGCTCAAGTCGCTCAGGCCTCGCAGACCGCGTCGGACATCTCTGTCGTCGTGGGAGGTTGCGTCGCACGCTTGGCCCAGCGCGTTTAC
GCGCTGGAGCAGAGGTTCGCTCCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTCGTGCGGCAGGTATGGCTTAAGCCGCCCGACGTAAAA
GGTCGGATGGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACACCGTGAACGGCCCAATGAAGCGCGGAGCGAGCTTG
CTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTCTTGAATTCATTAGTGTTGCCCCTACCAACAT
TGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCGATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAATTTGATTGCGTCCGA
GCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTCTTG
CTCTTGTCGACGTCTGTGCCCTGCACAGACGCGTGCTTCTTCTTCTTGTTGCGCGTAGTCGCGGCTGGCACTGTGCAAGTGTTAGCGGCATTCTGCGACT
GCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGG
TGTATACCCGGTCGAGGCATGCACCGAGTTGTTGGTGGCGAACTCTGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTAAGCGTAGCTCTTAAGC
ACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGATCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTT
CTTGCCAAAGGTGTGCACTGAAGCGCGGGACTCGATCCGACACAATGTCGATCGGCATGCCATGGCGTTTAAACACCATGTCAACGAACAGACGCGCCGT
CTGCTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGG
GGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACAC
GTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTACGTCTTCTCACGGCC
CGGATGCCCCGCAGTCGGTACATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACT
GCACTGTAGAGTAACAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGC
CGTAGGCCAGCAAGAGCTTCGCGTCCTCGTCGTGCGCGAACGCGACCTTCACGTCGTCCAACAGTGATGACGTCGGGGTGCTCGATCGCATGGCGTCAAT
GGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGATGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTA
TACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCGTATAGACCACGAACG
GTTTGCTTCCGAGTAGATACACTCCGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAG
CTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGG
AACGGGCGATCTGGGTTGGCCACCGCCAAGATCGGCGCCTCAGTCAAGTCCCGCTTGACTGCATCGAAGGCCTACTGACACTCAGCAGTCCAAACCCACT
CGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCAAGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGAAG
TTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGACGGACACCGTTCTTCCCAACGAGCCACCCGAGCACGGGT
ATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGTATGAGCGCAAGCAGCTTCCGGAGATGGACCTTGTGCATCTCAA
CATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCT
GTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCATAGCCGTGAGAGGGATATCGCTC
TCACGCATTAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATAACATCTTTTCGAGGTATCG
GCGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCTCCAGCCGCCCTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCT
TTGCGACGACTTTCGAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTACCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAA
TCTCGTGCTGGATTCCCTTGTCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTTT
CAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGT
TCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGA
CTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGT
CTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGATCTTCGCATGCGCCGT
CTTCTTGTTTTGCGGAGCCCGGCTCCGCTTCGTTCTTGACCTCGTCCAGGCCCAGCCGTGGGCGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCC
GCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTACAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCA
ACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGTCCTCCATTACGGAGGGTGCGTCG
GCTCCCCGAGCCGACGAATCAAATTTGTCCATGCTATCGACTCCCGGAGTCGATGCGACTTCAATACCTCGACGCCAACCATTGGCGGAGACCCCCATTA
CGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCGCCCAAGCCATCGACTCCTGGAGTCGACGACGTTACGTCACCTTGGCTCTAATTATTGGC
CAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGAGTGTGACTCGCCTGCGTCATCCGTGCCCCTTCAGGCCGGAGACTCTTCCTGATTC
GCTGAAAAGCGGGTGTCGACCTCCGAGGTCAACACATTTCCTTCATTAGCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGCGC
GCCCAGGGCGCTCCGGGACAGCGGCATTGGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCAC
TGTTCCGCTGTCGCGACCGAAGCGCACTCTCGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAAC
TTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCAC
CCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCC
AGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGGATAA
GCCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTTGGGCGCCCCGCGCCTACTGGCGTCCAGCGTT
TTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAACCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCAT
CGGTAGCATCGCACATTGTTTCCTTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGC
GTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATAGCAGCTTCGAGAGTTCTCGTGTA
CTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGTCCCTTCATGAATGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAG
ACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACCCCGCCCTCGACCGGAACTCGTTTCGCGGTGGCT
CAAACGCTTGTCTGAGCTCTTCCTTCAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTTCATACGCCCAACTTCTTGCACGTCCGCC
AAGACATGACATGGCGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCG
CCCTCTCTTCCAACGTAACTGATCACGCGGAGCTTCAGCGATTGCACGCGCGGTGTCGTCCCCGACGACACCGTGGTAGACGAAGCAGCATCTCGCTGCT
CCCTCATGATGAATCCCAGAGCAACACCATGCTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCG
TTGGAGAGCTTCCCACTCTGGGTCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCACGCGTAGTGGAGCTTTCAATGGACACCCCCGTATCC
ATGGGAAGGTTCTCAGCTCCGCGGTCGTGGGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAATGTGCTACCAGGTGTAGTGGGCCTAC
TTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGCCACCGAGTATAGAT
TAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGATAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGAT
AGGAATCTGCCAACGGCTGGTTGGCAAAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGTAAGAGATGCTGCTCTTAGCCAATAGGAATCCAAAGTC
TCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTATACCAAGGT