Description :
From Genome Similarity Track
Location :
Scaffold_6:1307306- 1308714
Transcript NameFunction/comments
Physo_336662Hypothetical protein

Sequence
1408 bases(100 bases per row)
TGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGC
CACCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGATAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATG
TAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAAAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGTAAGAGATGCTGCTCTTAGCCAAT
AGGAATCCAAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTTTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCT
AACAGACGTCGTATCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTTACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCAC
GGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGC
CGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAATACCATGAGCGCCAGCAGGCAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACTCAG
TCGGAGATTGTTCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTATGGGAGTGACGACGAAGAGATGGAAGAGGGCGAGGCCTCTTCCAACAAGC
GCAAGGAGTCTATCGACAGTGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCG
CGGCGAGAGCGAAACTCCGCTCTCCGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGTCGTCTTCAAGTTTTCCGCGCGCTGCTCAGGCAGCGCGCGAT
CCGTGGACGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCCTCCAAATGAAATTCCGCTGTACGTATGCAGCGGGATCCACGATGATG
CTGTGGCGGAGGAGTAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCTCCAGCAAGAAGAC
CTCTTCTCGCAGCAAAGTGCCTAAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAAGAAGAAGCCGGCTGCTTACCGTGAGCGG
GTTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCGTGCGCTGTGC
CCGAAGGC