Description :
From Genome Similarity Track
Location :
Scaffold_337:13071- 14971
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_337-fgenesh-gene-0.2Ubiquitin carboxyl-terminal hydrolase and/or F-box protein

Sequence
1900 bases(100 bases per row)
AAACGAGCGCGCCGAGCTGCGCGTGCAGATCCCGAACTTTCCAGCGTTGAGCTCCATGGCGGTGGAGAAGATTGTGTCTGAGACGTTTGCGATCGGCGAG
CACCATTTCTGTTTGTGGATCTTCCCGAATGGCAACCCGAATGAACAGCAGTACTCGGGCAAGGTGCTGAGCGTGTACCTCGTGCTCACGGATCTGGACC
GTCGCCCGCCTTCGTGGCTCACGTGCGCCGTGTTCTCGCTCTCAGTCGGGAACCACTTGGACCCGCTCAAGCGCATCGAGTGGCACTCGTGTCTCGTCGA
CAACAAGTTTGACAGCCAGCTCAACAACTGGGGCGTGCACTCGCTTGGGGCGCTCAAGACGCTCAAGAACCCCGCGAACGGCTTTCTGCTCAATGACACG
CTCACGATCACGGCCAAAGTGCGGCTGATGAACATCACGTTCCGCGTCGTCCGTGAGCGTGACTTGAAGAACCACCGCCACTTGGGGCTCACGGACCTCT
CGCAGGTTGATACGATCGAGCTCCCGTTCTGCTGCACGCTCCAGGACTTGCTCAAGAGGCTCAGCGACGAGTACAATGTTGACCCAGATCAAGTGAACGT
GTGGTGCTTCAATCAGCCCGTGGTCTCGGGCCAGGCGCTGCGACCGCGCAAGCTGCTCACGCAGGCGAAAGTGAACAAGCACCAGCCCATGTTCGGCAAC
CTACTCTGCGACGGCGTGGACATTGACGCGTACTCGTTCTGCCAGATCTATGTTGAGAGCAAGACCCAAGACGACCCGCCGCTGGATACCACCGCAGCAG
CGATGATGGTGGACTACAGCTCGTCGTCTGCTCTGTCGTTACTCAGTGGTGCTTCTGGCGCTGCTGCTGCCTGCGCTATGGAAGGCGACGCTAGTGGCGT
CGTGCCCGATGGCTACCTGTTTGTCAAAGTCATGAACCCAACTTCACACCAGCTCGAGTACGTTGGTCGCATCCACTTTGCGCCGCAACTGTGCTCTGGT
GCGGTCTACGAGTGCGTCGCCAAGCGACTGAACTGCGCATCATCCGAGATGGTCATGTACAAGGAAGAGATCGCGCCGACTGTGCTCTCGGGTCCGATCC
CGTGGAGCAGCGAACCACTTCAAGCGCAACACGGGCTCGAGTTTACGCTCCACGCAGCTGACATTGTGATCTTCACGCTGCGCACCCAGGCCGCGCAGAC
GGCATTCGCTGGCGCCATGAAGAGCCTGCTGTTGTCACAGTACGCAACCGCCGAGCTCCTGTTGGCAGACACGCCCTTTGCGACTGTCCCCACGCTTGAA
GCGATTGAGAGCCTGGCGGAGAAGCTCGACATCCCAAAGTTCCGCGTGCGCAGCGCGTTCCGCAAGTGCCGCGAAGATGGGCGCAGGACGCTCAAGTACA
TCATGGAAGGGCGGCATCTCGGCTTCATCTGTGACTCGTGCGGCGAGACGGACTTCAAAGGTCCGCGCTTCAACTGCTCGATGTGCACGGACTACGATTT
GTGTCGCGCCTGCAATGGTGAGTTTGGGAAATTTGTATTTGTATTTGGTTTTGAGTCTGAAGGTAATGATCTTCCTTGCTGACACTGTTGTTCCCTGTTT
GATGTGATTGAGCAGCTCAATGCCACGAAGTGAACCACCGGTACGCGAACGTGGACGGCAAGTGGCAACGTATCTACAACTTCAAGGACCACAGCGTGGC
GCACCCGATGCGCGAGATGATGCCCGTGTTCTACCAATACAATAAGAAACAGGAAGCGGTGAACGACTACAAGAAGCTCGTATCATCACAACAACAACAC
AACAACAACCTCCAGCATGTGCACTAGTATAGATCAAGCTTCACACAACCAGAAGGAAAGCTTTTGCCAAGGTTCGCGCTTCCACAATAGAAACAAGAAC