Description :
From Genome Similarity Track
Location :
scaffold_15:130704- 131749
Sequence
1045 bases(100 bases per row)
TACGACTATAGCCTgcccacataaaatgtaGGATGTAAGCGCATGCGTGTATGGATGGCTATTATATACGCATCACAATTGCATTTCAacaccttaaacg
gtcccaTGAATCTTGGTAAAAGCTTCCTGCTTTCGAAGTTGGACACTGCATGTTCAGGCATATTCAAGCAGTAGAAGATCATTGACCTTACACACATTCT
TGTTTCTCCTTATGCGCTCActgcttgttctttttgcagatccTGAGCTTCCGCAATTGTGTCTCGAACAATCCAAACAACGGCTTGTCTCTTCGCAATT
AAGTCATCGACGTGCTGTTCCTTACTACTTGTTATGTCGTCTAGAGGTCTAATTGTGTCCAAGTTTGCTTCTAActctgtgacagcatttaggTCTGACT
GTGGCTCTATAGCCATAGTCCCCCCACTTTAGGTATAGATCTAGCCCATTATGGAAGCATGTACTTAAAGACGAATAGCATAGTTCACATAAAATGACGA
ATGACCTGTCGAGACACGCGTTAAGTTGTTCAACTCAAACTCGGCAAAAGAGACAAATTCACCGCACTCTTTGAACGACGTAGCGTCATTACGCAGTACG
TCTTCCGGGACTTAATTCAAATGCTCTGTTTGACGGTCCATTTTAGTGTGttccgctgttgacacgaACAATTTGTTGCCCAATAGTCCAAACAGTTTGT
GTTACCGGACCggttcagcaagatggttcctTTTGCGCCTATTTCGGAAAAGATCTCTGCCGATAAGACAGCTAAGGTCTTTATAAATGTTGTTTTTCGC
TTGCATGGCCTTTCTGTTGAGATCGTGTCTAACCGTGACATCCGTTTGATGTCGAAATTTTGGCGAGCATATGCCACTGTTAGGTGTGCCATGCGGAAGT
CCGAAAATGATATCCATACTCACAGACTTTCAGTTGTCAGCTGGCACTGCCAACGAACGAAGTGTGGCCTGAGTAGACGTTGCGGTCTCACTCTCTGGCA
GATCTCATAAGTCCTCACATACTTGCGCACCCACTCAGACATGTG