Description :
From Genome Similarity Track
Location :
Scaffold_59:1307- 5413
Transcript NameFunction/comments
Phymu_g3026pleiotropic drug resistance protein ABC superfamily

Sequence
4106 bases(100 bases per row)
GCCTTCCACGAtctcgtcgtgcagcagctcgaaccAGCTCTAGGACGCCTCCTACCGCAGATGGAAGTACGTTGCAAGAGTTTGTCGGTCGTCGCTCAAG
TGCCAGTGGTGAAgcagtcgtccagctcgacATCCGAGCTACCGTCCGTGTACAACAGTCTCAAGCACGCAGTACGGGAACTCACAGCAACCAGACAGAC
CACTGAACGAAATGTACTGAATCAAATCGACGCTGTGTTCGAACCGGGTACAATCACGCTGATCCTCGGCCAACCCGGTTcgggcaagacgacgctcaTG
AAAGTACTGAGTGGCCAATTCCCCCTTTCCAAGAACGTCACGATCCAAGGTGACGTCGCGTACAACGGGCAACCGTGGAAGGAGCTACTCCCAAAGCTCC
CCCAGCTCTCAGCGTACGTTCCTCAGACAGACACCCACTTCCCGTCATTATCCGTGCAAGAAACTCTGGAATTCGCCCATGCGTGTTGCACTGAAGAGTT
CACTTTGAAACGTGGGAAGGGTCTGCTATCAAACGGCACGCCCGAGCAGAACCAAGAGGCTCTACGTGTGATAGAAGCACTCGACAAACACTACCCGGAA
GTGGTCGTCGAGCAACTTGGCCTTAAAAACTGTCGAGACACTGTCATTGGCAATGCATTGAACCGTGGAGTATCCGGGGGCGAACGGCGACGCGTGACCA
TGGGGGAAATGGAGTTCGGAATGAAATACGCGACGTTCCTGGACGAAGTGACAAACGGATTGGACAGCGCTGCCACGTTCGACATCGTCTGCACACAGCG
AGACATCGCCAAGAAACTGcacaagacggtggtgatggcgttACTGCAACCGGCACCCGAGGTCTTCGAACTCTTCGACAacgttctgctgctcaatgac
GGCGAAGTGATGTACAATGGACCTCGTGAACAAGCGGTACCGTACTTCGAAAGCCTGGGCTTCGTATGCCCTCCCGACAGGGATGTCGCGGACTTCTTAA
TGGATCTCGGCACGgaccagcagtaccagtacgAGGCGAAGCCAAACACCGGTTCTCCTCGGTTGGCGAGTGAATTTGCGGACCTCTTTCGCCAGTCTGC
CACCCACCAGAATCTACTACAAGCGCTCGAGACACCTTGGAGTAAGGACCGCTTGTATGATGCCGAAGAACACCTTGCCAAGATGACACAGTTCCGGCAG
TCGTTGTGGGCGAGTGCCTTGGCGTTGACGCGCCGGCATTTGACCATCGCAATGCGCAACGCCGCGTTTATCCGCGTGCGAACGTTCATGGTTGTGGCTA
TGGGGCTCGTGTACGGTAGTACGTTCTACGACTTCGATCCGACCAGCGCACAGGTAGCGCTGGGAGTACTCTACCAGACCACCATGTTCCTGGCGTTGGG
GCAGGCGTCTCAGATGCCCGTCTTCGTTGCGTCTCGGGATATCTACTACAAACACCGGAGAGCCAACTTCTACCGCTCGCTTTCGTTCGGAATCGCAAGT
TTAGCTGCGTTGTTCCCCCCTGCGGCTACTGAGTCAATCGTCTTTGGGACGTTCGTGTACTGGATGGTGGGCTTCGTAACAGAGGCGAGCTACtacctgc
tcttcctgctctgtATGATCCTGACCAACCTCGCACTATGTGCGTGGTTCTTCACGCTGACCGCCATGTCGCCGAATTTCAACATCGCCAAGCCAATgtc
cacgttctccatctcgctcTACGTCCTCTTCGCGGGTTTTGTGGTCCCAAGGAGTCAGCTACCGCATTTCCTCGTGTGGATCTACTGGATCAACCCGGTC
TCGTGGTGCTTGAGAACGCTGGCTGTGAATCAATACCGCTCGCCTAAGTTCGACGTGTGCGTgtacgacggagaagacTACTGCGCCCGATACGACATGA
CCATGGGCGAATACTCGCTGTCGCTCTACGATGTGCCTTCGGACAAGTCGTGGGTCTGGTTGGGAGTACTCTACCTCATGttctccgtcgtcttcttcgt
agtGGTTGGTAGTTTCATACTCGAGTACAAGCGCTATGACGTCCCTgacgctgtggctgttgttgccATAAATGAAGACCCACACAGAGAGAAGGAACAG
CATGGAAACTCCACGAACTACGCTGAGGTCCACACGCCACGCTCTGCCTCCAATGCAGTCGATATGGTTGTTTTAgacctggacgagcaggacaGATTCG
TACCTGTTACTCTGGCCTTCAAGGACCTCTGGTATTCCGTGCCTCTGCCCCACCACAAGCACGAATCCATCGACCTGCTTAAGGGGATCAGTGGATACGC
TCTGCCTGGCACCATGACGGCGCTGATGGGGTCTTCAGGTGCAGGTAAAACGACTCTCATGGACGTGATTGCCTGTCGAAAGACCGGAGGTACCATCAAG
GGAGAGATCCTGCTCAACGGATACCCCGCCACGGAGTTGGCGATCCGACGGTGTACAGGTTACTGCGAGCAGCAAGATGTTCACTCGGAAGGAGCAACAA
TCCGAGAAGCGCTCACCTTCAGCGCTTTTCTTCGCCAGGACAGCAGCGTATCAGAACGAGCCAAGCTCGCATCGGTGGAGGAATGTCTGGACTTGTTGGA
TATGCGCGCCATCGCGGACCAGATCATCCGAGGTCGATCCCAagagcagatgaagcgcctgACCATCGGTGTAGAGCTTGCAGCACAACCGAGtgtgctg
ttcctggatgAACCTACCAGTGGTCTGGACGCTCACTCCGCCAAGGTCATCATGGATGGGGTCCGCAAAGTGGCTGACAGTGGCCGAACGGTTGTGTgta
cgatccaccagccttcgtccgacgtcttcttcctgttcgacaGTCTCCTGCTACTGAAACGTGGTGGTGAGatggtcttcttcggggAACTCGACAACGC
GCAGCCGGATGATCGCGAatgcagccacttgatcgACTACTTCGAAGCCATTCCGGAGATCGCCCGTTTGCCTGAGGGTCAGAACCCCGCGACTTGGATG
TTGGAGTGTAtcggtgctggagttgccGGTGCAGGGGAGAAGGCTGTGGCAAATTCTACCACAAACGTAGATTTCGTACGGCATTTCCGAGAGAGCGTGG
AGCACGAGGCGATGGTGCGAGGGCTTGACCGGCCTGGCGTAACGAGACCTGATCCTGAGCGGCTGCCAGAGTTGGTATTCTCGAGCAAACGCGCCGCTAC
TCAGTGGATGCAGCTCCGCATGCTGGTCGGGCGGTTCTTGACGATCTACTGGCGCACACCTTCGTACAACTTGACTCGATTCATGATTGCTTTCGGACTG
GCCTTAGTTTTCGGACTGGTGCTGGTCAACGGCCAGTACACGACATACCAAGGGATCAACTCGGCCGTTGGCGTTATCTTCATGACCGCTTTGTACCAGA
GCTACATCTCGTACGTTGGCTGCTTGCCGTTCACTGCTCGGGAGCGCGTGTCGTACTACCGCGAGCGAGACTCGCAGACGTACAGCGCTTTCTGGTACTT
CGTAGGAGCGAGCGTGGCGGAAATCCCGTTCGTGTTTGGCAGCGGCTTGATCTTCACGGTCATTTTCTTCCCGTTGATGGGCGTTGGCTCCTTCGGAACT
GCAGTGCTGTACTGGATCAACGTGTCGCTCTTCGTGCTGATGGAGACGTATCTGGGTCAAATGTTCATCTACGCACTACCgaccgtcgaggtggccgcCA
TCGTTGGAGTGTTCAtcaacgccatcttcttgctgttcgcaGGCTTCAACCCGCCGACCGCCTCCATCCCGTCCGGTTACATGTGGGTCAGCTACTTGAC
ACCCAACCGATACTCCAACTCGATCCTAGTGGCGCTCCTGTTCGGGCACTGCGCAGAGGACCCAACGTACGATGAAGCCACGCAGTCGTACACGAACGTT
GGCTCGGAGATCGGCTGCCAGCCGCTGGAAAACGCGCCGCTGTCTGTCGGCCACACAACAGTGAAGAATTACATCGCAGACGTCTTTGAGATCAGGCACG
ACGACATCTGGAGCAATTTCGGCTACATCTTCCTGTACATCGCCGTGATCCGCGTCATTTCACTGCTGTCTCTCCGATATCTCAACCACCAAAAGCGGTA
GAACAG