Description :
From Genome Similarity Track
Location :
Scaffold_95:1307- 5082
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_95-fgenesh-gene-0.0Proteasome activator complex subunit 4 (Proteasome activator PA200).

Sequence
3775 bases(100 bases per row)
CGGTTTTACTTCTTCGTACTTTCCTGGCTTCCGCTGGTAAACGACGTGGAGAAGAAAGGTGATGGCAGTTTGTTGGGTCGCATCGACGTGTCGAACGAGC
TCTTCAAGGAAATGGAGGTGAACACGTTTGCAGCGATCGATCCCAACGGACCCGAGGTTGACCTCAAGATGTGGGAGTTAGGCAGCTTCTTGGAGGAATG
GTCACTGGCGTTGCTGGACCGCTGCCTGGAGTTTTTCCGAACACGCGCCAACACGCAGAGCCACGACTCCGCCTCCAAGGGCTCCAGTGATAGCAGCGAG
CATGCGCAACGAGAAGACGCAGTGGTGATGGAAGTGCTTGACGTGATGAGCCTTCTATACGGCCAGATGTCACCGTCGCTCTATTCACAAGCGCTTCGCA
AGACTGTGGCGTTCGTGTCAGGCTCGTTCTTCACCTCCGAGTTTGGTGGTAAAGTGATCAGCTCGCTCGTGTTCAACTGTGTCCAAGGAAATTTTCAAGA
AGCTACTCCGTTGTTTCTGCGGGTCGCACTTGACAAGCTGCACGTCTCAAAATTGAAGGCGTTGATGACGAATGAGAAGGTTTGGTATCTACACATTCTG
AACGGCGCCGTTCGTGCGAACGACTCGACCGGGTCTACACTCCTGGCGTACCGTGAGGAGTTGCGGGTCGTGCTTGCCCATTATTTGATCCACGAAGAAG
ACAAAGAAGTGTACGAGGCCGCTGGTATTGTGTTAGAGGATTTGCTCCACGCACTCGCCGGGGTGTACCCCTTAGATTTTCGCTCCCTGCCACCTCAAGA
ATGGGCCACCGCGACAAGTGCGTCGACAAATATGTTCCAGTTTCTCGGAGCAGCTGTGTCGTGGAAGCGCCTGAACGTGCAGTGGCACGAACCCAATGAA
CAAGAGCTTGCGTTTGCACAAGATCTTTTGCAAGATCATCTGGTCGACACGTTCACCACACTTGGCAAGCTGCGAGCAAGCGGCGACGTGAATGTTCGAG
ATTGGATCCCGCATCTGAAGCGGGTGTACGTGAGTGTCCGTGGAGCGAGAAATTTGTTGGTGGACACGACGCGCGGTCCAAGTGCTTTGCAAGCCGGTTC
GCTGCCGATGCTCGTGCGTGGTTGTGGTGCCAACTCGACGCTGCTCGATTCATTGGTATCTCTCAAGGCTCGCGTGCTGTCAGATATCCACGCGATCGTT
GGTCACTGGCAAGTGCACGGCCAAAAAGGAGTCACAGAAAACCTGATCTGGAAGGTGCTGCTCAAGGTCATGAAACAGCTCTTGGTGTGGCGCGGTAGCC
ACCTCGGCAATCACCGGTCCAAGGAGAAGCAAAATTTGTACATCAAGATGATGACAACTGACGTGGCATCCAAGCAACTTCGAAAGTCACGTCGTTTCGA
CCAGGATCCGTTGGAGATCGTACCACTCTCTTCGCGAAACGAAATGGTTGAGAGGGTGCTGTTTTTCTACTCAAAGCGCAGGGTACAAGAGCATTTCGAA
ATGGCCCAGTTTGTTCTGGAGGACGGAGTGTCTGGTCGCGATCAGTACGAAGCGCTGCTTCTCGATGTCGATGAATTGACAAAACACACGTACGAAGAAG
TTCGAAATGGGGCAAGTGCCGTCATGCGCGACAGCTACGAGATCTTTGTCAAGTGGATCTACGCGCGTGTTTCAGACCATCTCGATATTCTCGAGGGCAA
GATCGTGGATGACAAGGGTTACGTGAAGGAAGAGGCCATCTCGGGTGCACTCGAGTTTTTGCGTAGATCGCGGGTTTTGGCGTACCTCTGGAAGAGCCGG
GACGCGCTGCTCGAACGCGCATTGACGGCCGTGCTGGCAAGCAATGATGTGGTGATGAAGAAGGTCGAGACAGAGGCCAGTAAAGCCAAAATGAGCGTCA
AGATCCAGACGTTTTTCCTCTCACTCATGGCCAGTTGGCGCTATGTGCGTGAGATCTCGTCGAAGAAGCTGGTCACGGCGTTGTTGGCGGCCGAGCCTCC
ATCCTCGGAGCACTGGAAGCAGCAGCTAATGCACCTTGTCTGTTTCTTCCCGCTGCTTCAGCCGAAGGAAGTACCTTTATCCACCAGACTCTGGCAGCTT
GTGATCCGGCGACTCGAGCATGACGTGCTTCCAGTTCGCCAAGTCGCTATGCTGCTGCTCTCCCAGTTGGTCAAGCTTGAGAAATGGAACGCATCTGCCA
CCGGAGCCTACAACACGGATGTTTCGAGTCTGCTTTTCTCCGAGGCTACACTAAAGCTGCTCGTCACGTCGATGGTGGAGAACCATCGCAATAGTCACCG
CTTTGCAGCCTCCGCGGATGGCCAACACGCTAACTCGGCTCCAAGCGACTGGTCTTTTGGCGTGAACGAGGTTATTCGTAGCCTTTCAAACACGGCCAAT
GCGTACCCAAAACCACCACCACTCTCTTCTATTCGTCTCCTAAACCAAACAAGTGATGCGCTCAAGTCCCTTAACATGACACACGTCAAGCTCGTGCAGC
GGTTGACGCGGATCAATCCTCGTGCGATCCTGCAAAACGGTATGCTGGCAACGCTAGAGGATCTCACGAGTCGAATCGACTCGAAAGTTTCGGATGAAGA
CCGTCAGGCGTCATTGTCCACGTTGGGTGAATGGACGAGTGGCATGCTGCGATCGGTGCTCAAACTACCTAGTGAAGAGGACGCTTTTGCGACCTCTGCA
GTCTCATCCATCACAGATCTCGTGAAGAAGGTCCTCTCGAACATCAATCTTGCTGTCGTCGAGCCGTGGACGCAAGCCTTGTACTATGTTTCGCGTCCCG
CAAACACCAGCTCTGCTGAGCTGCAGCTCGCTCGGCTCGACGCCGTCGTGTTGTATGTGTTGGGTGACTTTGAGGCATCGTTTGCAAGGGCAACCGTCGA
CGATTACGCCGATCAAGTCAAGTGGATGAGTCTTCTCGAGCCGCTTCTCGTAAACCTGCTTAGCTCGGATTCCAAGCGACTGGCTACCGTTCAATCTTCC
ATCCGCAGCTCGGTGGTTGGTGTCATGGACGCACACGCGCTGGCGCATCGGTACAAGATGGTTCGCGATCGTGCTGCCAAGATACTCTATATTTTGGAAG
CCAACGATGACGATACTGGATCAGACTCGCGGCCCACTACGGTGCTGCTGAGCAAAGTCGTGGCGTTGAGCCAAGTGAACTCGACCAACGCAGATGACAA
CAACGAGGGGGAAATCGTTCTGAACGCCAAGGAGACCGCAATGCAGTGGCTGGTCTGCGCCGAACGCCATGGTGAACCGCGCGACTTTGCGCGTATCATG
AAGCCGCTCTTCCCGATTGTCTTTTTGAGCCAGAACCACTCAAAGGTCGAGATCGCGTTGTTGGCCAAGAACACTGCAAACGCGATCTCACTCTCGCTTC
GCTTGTACGCGCCCCCATCTGATGCCGAGGCGTCTACGCACTTGGATGAGTTGATCGAGATGCTCGAGCAACTCGCCACACACGATTTGTGGAAGACCCG
CGCCGGTGTGCTCCGCTTTCTGACGCTATTCACGTTTTACCACTGGCTCTTCTTTACGCGGGAGCAGCAAGAACGAATCCAGCAGCTTGTCATGAAGTTT
CTCGCAGATGAGCAGCGTGAGATTCAAGACATGGCCAAGTACGCACTGCGTAGTCTTGCCCACATTCAACGGTCAGTAGTCGTCTCGGCACTTAGTCGGC
AACTGACTGAAGCGGCCAAGGATGCACGCGTAAAGCACCCGAAACTCGTCCGCAGACTACTGAAGCAACAAAAAG