Description :
From Genome Similarity Track
Location :
Scaffold_231:1307- 2856
Transcript NameFunction/comments
Phyca_LT1534132782Hypothetical protein

Sequence
1549 bases(100 bases per row)
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatcgctctcgggctttgg
actggcaggagtgtgtaccgaaagtatcacctcaagttggctgaagtgaaggcggtcgtggacgaagatgataggagctgtactggtttcaattctgaag
tcaacactccaacggtggtgagactcaagtccactgtgttgcgggggcacggtgcttgaagaagaacaggaggctcgtagaagacagaagagagtaaaaa
gagaagtaagattaatgtttaagaaagtagcagggctactaacaagaaactagtatgcggcattcagaaacgtagtctagaactgccgctaccattcatc
gtactaatgttccagacattttagtacactaattattagagtcaaaagtaccgtgtctcttcattattagtttatagagaacacggtgtagaggcggtcc
ctgtgacgggccctaacctcaacagcctccctggatcgacatcagggaacgtcattggataatataatacacgtgttttgattggtccacaaaaaacctg
ttaaaagtgttcagtcaatctacaaaatggctacacgaattcgtgttttttgcgtttctgaagctcctggagggcctacgggcaaacggaggccggattc
gggctctcctcgtcaggggttcctccaggcggtttgactaatttgccacttgtgcacgagctgtcatatttagaaatgacagcaatatcgaaaaaggaat
tagttttagagttataaattcgtacaggcacagacattgaagatagacaagtacgtggccattcagtgctgttacttcgtcttatccaacaggtgcgaag
gctttcagagggttggcaggcgccacatgcaagcatagacttcttaaagaggctgccagcagttcacctggtgttcacataccgtttcaaaggaatagag
ctcgttagagcgttctgctgagcgtagaacttgtaatgacacgttctttcggcctcacaacacaatttcaactcattttcactcttgcctccatcagggc
atcgactccagcagctcggagcttcctgcctagtattctgcgcacctacggacctggctgattggtctggggctctgttatcaaacgccagccccagaga
tcatgccacggaccagtttggttgcacaggttactatgaatgaaagaatacaactcaactccttttgcagtgcgcctacaaaagctattgtcgtgtctac
cgctactgagatcgacatgcaacctgaagactcaaccttacttcatctttcagcagtacatctatcgacagaaccctcttcgatggcatcagagccactc
caatcgtcagcggcgtcagtggcggtagcagaggcatcatcaaccgtgcatcttcgtcggagcaaccggtctcgccatccaccccaaaccaatgtgccag
cattccatgcccggccacgaaaaataaagagacggcgtcggagcaaaaa