Description :
From Genome Similarity Track
Location :
Scaffold_443:13066- 14495
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_443-fgenesh-gene-0.4Major Facilitator Superfamily (MFS)
Pytap_DAOMBR444maker-pag1_scaffold_443-snap-gene-0.11Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_443-snap-gene-0.10Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_443-fgenesh-gene-0.5Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1429 bases(100 bases per row)
AATTGCCATGAGCAGTGTACCAAACTCGAGAACCGCCGTAAGCTCACGGATCTGCCAGACGTCGCCAAAGTAGATGAAAAGAAGCACGCAGATCGCTGGA
CCGAGTACCATGGCGAGGTTGCTgaTGTTGTACTTGATCATGAAAGGGAACGAGCGCTGGCCGTGCGGGATCGAGTCTGCGAAGAGCGCTTCGAGTGCCG
GGTTCTGGAACGCAGCAAACATACCCCAGAGCCCAAACACCACGTAGAGCAGCGTCAACGACGTCTGCTCCACAGCGAGGAACGTGAGCGCCGTGGAGAA
TAGACCAATAACACCGGAGATCTTGAGAATTGTATCGCGGCGCGTCTTGTCAGCAAAGTaTCCAGCTGGGAACGAGAAGATGAGCTGCGAGATACCTTGG
ATGCCCTTGACTAcGCCCACGGGCTTGTTCGAGTTGGTCAGCACGAACACATAGCCCGAGATGATCTGCTGGAAGAGGATCGAGCGCGCGGCCCATAagA
AGAAAGTGACGACGTACGCGGTCTTGACGTTGGGTGAGATGtCGCGCCACCACGCCGCCATGATGCTTGCTCGTGAAGCGCAGAGGCTCTTGGgAATGGA
GGGTGCAGCGAAAAGAATCCGTTTGGCCCTTGGgACATCCACGCGCACACATCATCAGACTATGACCAGCGGTCTTGAGATTGGATTGGTCGAAAACGAA
TCCcATTCTATATTTTGCCACCAATCGTACCACGTTCTAGAAAATTTCGAACGACTGATTGGCTGATTTGTCTATCAAATGGGTGAGTCCGACGTAACGG
AAATCAGTACGTAGATTTTGTATCACAGTGGGTTGAGGGGATTCGCATTCACCGTCTGCAGCTTGGCTCTTGTGCTTGGTGACAGCAGCTCGCTTGTTGG
CTTGGCTCTTGATGGCACGGGAGACTGCACGTCCGCCATGGGCCTGCCTCGAGTGGATGGTGAGAaCAGCTCGCTGTTGTGGAGCTCGAGGATGGCTGAC
GTGAGGCTCAGTCGGCTTGTGTCGTAAGTTAGAAGGTCGtCTTTCATCGGTGCGAAGTTAGGCGAGAGCTGAGGCTGGTAGTGCAGTAGCGAGCTCCAGT
CCGTGCGTGcTTCCGAGTTaTGGAATCCATACAGGAAGTACCATGCGACGGCAATCGCGAGCcACCCGAGGCTCAAGACGAGTCCGAGGgTGCTGAGCTG
AGCCATCATGTAGAAGTCGGCAATGATAGAGATCGTTGGCAGCAATGGCACCAATGGCGCCCAGTAGATCTCTGGCTCGTTCATCTCTTGTGGGCAATAC
CAAGCGATGTACAAACATGACAGAAGACAAGCTGCGAGGAAGAAGATAGCGATCGCCAATACTGCGACGCTGCGGTCTTCCGCCGCGACTTCGACGTAGC
CCATTTGGTAGATAAACGTGGAAATGAGC