Description :
From Genome Similarity Track
Location :
scaffold_327:13065- 14542
Transcript NameFunction/comments
Pl_106063conserved hypothetical protein
Pl_106064hypothetical protein PHYSODRAFT_352068

Sequence
1477 bases(100 bases per row)
GTAGTCGTCGGGTTCATGCTCTCATCGTCGCTGTAGCCGAAGCTGGACGACGCCGTCTTGATGCCAAAGTTGTACCTCTTGTTCACAATAGCTGGGATGT
CGGTTGCGTTATTGCGTACGACACGAACTGTGCCCAGTCCTCTGGAGGAAGAGCTGCTGACTCTGGACGAGCTCTTGCTGCTGTAGCCGTGGTGGGGGCC
TTGACGTTGCCGGCGCTGGGACAGCACTTGGATGTCTTTGGGCATGAAGGCGTCCGGCACGAGTTTCTCCGAGTTGGACAGGATGGAGGCCACTGACGAG
TCCGTTGTGGAAGACTGAGAGCGTCCGCGTCCACTCGCCACTTGGTCCAAGTCCCGCGCAAAGTCTTTGCTCTGATAGTGCTGCACACAGACACCAGTTA
GCAGAGGTTACTAGGCCGACAGAGACTGCACGCACCAGTTGTGGGTCGCTGTCACTAGGACGCAGTCCACAGACAACAGAGAGATTGCCGCCCATACGCT
CGACCTTTCGAATTTTAAAGAGTACAGGAGCGTCAGTCGACCTTGTCCAAACCGATCGATTCGATTATTTCCGAGAAATCTATTTGAACAGGTTTTGACA
GAATAAACAGGAATGTTCGTTTCGCTACCCGAATATTCCCATTTGAGCTGAATTCTTGCAGAAAGCGAGAATCGTCATGGCTGTGCGAGTGCGGCGATGG
AGCGACGTGGAGGCGCGCCGCCGGCCGCTGCACCGCGCTGCGTACGCCAACAGTACACCGAGTCCTGCACCCGTTGCCCCTGCATCAGCTGAGCCTGCGC
CAAACGCCAAGAGCGTCCCGTTAGCGGTGATTGAGGACGCCCCCGAGTGCGTCATCTGTCTGGACGAGCTGGCGCTGGGACGCGCGCTGTTCACGGCCGA
ATGCGGCCACCGCTTCCACTTCAGTTGCCTCTTAGAGAACGTCAACCACGACGAGGCCAACTCGGACAAGTGTCCGATCTGCCGCAAGACGCAGACGCAG
TGGCCTGAGCAGACGGAGGGACTTGTCAAGGCCCATCCGTACTGTGAGTTCCAGACGATAACGACCTTGGTTTTATAAGACATAGCTAATTGTCTATTGT
TGGACAGGTACAAATTGCGGGAAACGAGGCTCAGGAGGACAATTCTGTGACGGATGTGGACAATCGCTGGCACACACACCTACAGCTCAAGAACGTGCTC
GAGCGGCGGCTGCTGCAGCGGCAGCTAGGAGTAATGTGGTGGTGGAGTGCCCTACGTGTCGCATCCGCTGCCTGGTGAGCACTACGGCACGTGGAACACT
GCAGTGCCCCAATGGCCATCTTTTCCAACTACGGATGCCTCCAAGCATGGGCAATTCGCAGGGACTTCGACAAAGCTTCAATGGAGCTGGACCAGGCTCG
ATGACTTCGGGGCCCAGACCTATCATGCGTCAATGCCCTACGTGCTACACACGTGTGCAAATGCCCCCAGGCAGTCA