Description :
From Genome Similarity Track
Location :
Scaffold_60:130632- 132518
Sequence
1886 bases(100 bases per row)
GATGGAGTCAACAACGTACCCATTTGATGATGTTGAGATGCAAGAAAACGAACGGTGAGCTTGTGGCATAAAAAAGTATTAACAACATACCATCGAATAC
ACGAGTAGGCAGCTAATAAAGACATGGTTTTCAGACCCAAAAGGGAACGGTATAGACGCCCAATAGAACCAGCTCATCTACCTGGTAATGGATAGACCAT
GGTTGACAAGCGCAAGATGGATAGCGACGACGATCCTAAAAATGACGATCGTTTTTACCGCCGTCACCCAAGTGGTCTCGTGTTAATGAAGATAGCTCGC
TTTCAGAAGCTGTACTAGCCTACGCGGCAATTGTCAGGGATGCAGATGATGTACGAACGATATATCAACAAGCCATAAAACAGCGACGATGCCGGGGAAA
GGGTAAATGGAATGAACGCTGGAATTCAAAGCTCATTCGGAAAACGGTTCATGGAGGCTGGCCATGAAGATGAAGGAAGTCCGACCAATTGGATGGAAAT
GAGTGTTTTCTAAGAAGCACAACGAGCACGCACATATGGTACGGTACAAGGCTCGACTCGTTGCGAAAGGCTTTAAGAAGAAGTTCGGTGTCGACTACTT
CGAGAACCACTCGACTGTGGGGAACATGAACGTCATTTGAGTTGTGCTATCGGTGGTGGTCGCGAATGGATACTTGGATGAACTGATAAATACAGACACG
GAATTTTCGACAGCGAGATCAAGGAACGAGTATACATAGATGTGCTTGTGGTATTTCACACGCCGATAATATGATGTGCAAGCTGGATAAGGCGATCTGC
GGTCCCACTCAGGCTCTCAACGCATAGAACAAGTCGATACATGCTATATTCTTACAGGTAGGTTTTTGAAGTTAATGGGCAGATCAGTACGTCTACTTCA
AGGGCTAGAACGGACACTACATGTATGTGTGGCTCTACGTTGACGACATTATCATCGCAGCCAATACCAGCATAGAGATCCAGGAGGTCAAGACAGAAAT
GCAGAATTTGTTTAAGAGGAAAGAGCTGGGCAAGGTCAAGTTTTTTCTCGAAATGGAAATGGATCATGATCTACATTGCAGTAAGCTCATGATCCGACAG
ACCCGTTACATAGATGACGTGGTGAGCAGATTAAACCAACAAGACGCCAAGGCAGTGGATAACCCGTTTGAGTCGGTTATGAAACTATCAAAGATGCAAT
CGTCGACAACGTACGATGACAAGAACGAAATGAAGTCGAAGCCGTAACGATCGTTGCTCGGATGTTTGCTGTACATCACGACCTGTACACGTCCTGATAT
CGCGTATGTTGTCACGCAGATGTAGCGGCATCTGGAGAATCCGGGACAGCAACATCTGAATGCCGCTATTCACGTACTGCGCTACATCAAGCCGGCAAAA
AACTGCGGGATCGCTTACGACGGTAGCGCCAGTGAGATGCAAATTTAAACGTACACAGACACGGACTGGGAAATTAATATCGATGACTGATGATCGGTTT
CGGGGACAATGTTGATGATTGGTGGCGCACCAGTCGTTTCAAGTCCAAGCGTTAGCGTACAGTGGCTTTAAAAGCTCGACAGAGGCATAATACATGGCTA
TGAGCATGTGTACGTAACAAGTGTTGTGGGTCCAAACCATACTAAAGGATCTCGGTCATAACCAAGTGGGAGCGACATTGATCTAATAAAAAAAGAAGAT
AATCAGGGAACAATTGGACTTGCCAATAATGCAGGATACAATGTTAGGACCAAGCATGTCGACATTCGTCCTCACTTTTATCCGGGAGAACATGACTCTA
GATGTCATTGTGGTCAAGTACGTATCTAAGGTGGAACAATTGGCAGACATGCTGATGGAGGATCTAGGGGCCAAACGACATAGATA