Description :
From Genome Similarity Track
Location :
Scaffold_357:13063- 15605
Sequence
2542 bases(100 bases per row)
TTGAACGTTTCCCTCTCCAAGTCGATATACGTACTGTATATCTATTTGGAGAGGGGAGAGGGAAGAAACGTTCAACAGACAAATGACTGACTGACTTATT
TACGGAGAGTCGGAGTTCTGCTTGTGTGCTCGCATGACGACAACAGCATCAAGACAAAATTTGCGCAGCATCATGACGTGGTGGCGAATATGCAGAGCAA
AAGGTTTTCCTTCTTCTTCACCAAGGGCGGCTGGCGAGCTGGAATCTGGATAAATCTGGATATCTTGTCACTTTTCGCGTGGTGGTCGTCCTTTCAAATT
GGTCAAAGCAACCATACAGTAAACAAGTTATTTTTGGACAGCAAAACGAAACTTGGGAAAAAGAATCACGAAATCTGTTTTCTGATTCTTTCTCAGACAA
GTGGGTTCTTTTTTTCTTCCTTCATTACTCTTCATTTCTCCAAGGCCAAGAGCTCAAGACTCAGGAGAGCGATCTGCCTTCCTCGTTGGGAGCTCGTCGT
CCGCGTCCGAGGACAACAGCCATGAGTGGCACTGTTGTGGAGAGAATGCGCAAGTGAGTGTGTATTTTTGCACCACACTCCCGTCTTTTTCTCGTCATGA
GGCGAAAATGTTTACAAGCAAATGGTCGGTGCTGTGGCACTATCTTTAGCCCAGCGAAGACAAGCAGATATGTATACTGGTCGGCGGCGTGCAATGCACG
GAAGTGGAAGCTACTGCATCAGGCAACAGCACCTGCCAACAGCAGTCAGTGGGAGCATAGCATCTGCTGGGAGACTGAGCCTCCGACGCAGTTCTTCAAG
GTCGAGTAGCGAAGGCAACAGGCACGTACAGCATGCCATACCTGTAAGCAAGTAGCCCCAGCGAGTATCCAAGCTACTACAGAGCACCAATGGACAGCGG
CGGTGGCGAAATCGCGAGCCAAGCAGAAGAAGCACCAGTGGTGGCGACGGCGTCGCCCTCGAATGCGAAAGAGGGTTACCGAGTTCTCTACGCCTGCGGC
TAGCTGCTCTCGTCCTGAGCCTTCTCCAGCTGTGCCAGACGAGCAGGTGTTGTCACCACCCCAAGTGCTGATCCAGACACCCCGAGCAGCCCAACAATCC
TGGGGAACATCTTCCCATCCGATCGTTTCCTCCAGGTCAGATAGAAGCGGAGCGTGATCGATTGATGGCTCAAGGATGAACAAGACTCCCGCTCGGCTAC
ACGTATTCGTGAAAACAGCAAAGAGCTCAGACGCGAAGCTTTCTGGAGAACTGGTACGGGTACGAGTGGCCGGAGTACAGTGCGCGCCGCGACAAAGTGT
ATTGATTCTATTGCTACTTGTTTCCAACTTTGAACGCGAGCAATCGCGTGAACTGAAAGAAAATGACCTCAACCTCAGCAACTCACGCATCAATGCAAGC
ACACCTGCTGGCGCAGACAACACACCGAGATTGCCTGAACGAGCGACAGCACATCGACACGGCATTTGACACTCAGCGAACAGTGGCGTGCTGAATTACG
AGAAGCTGCGGCACGAGAACAGAACCATTCTCTCGCGCATGATTGACTCGGTGACCTTCCTCGCGCAGCAAGGGGTCGCTATTCGAGGCCATCACGAATC
TGAGGCTTCAAACAACAAGGGCAATTTCCTCGAGCTGATACGAGCTCCTCAGGAAAAACGATCCAATTATCAGTGCGTTCTTGGACTCTGCGCCGGCCAA
CGCACGCTACACATCACCTCAAACACAAAAGTAGCTTCTAATCTGCGTGGCTGCTGTCCTGCGAGCGAAATGCGTGCCGCGCTGAGTTCTAGATCATATG
CGCTGATTGTCGATGAGCCCGTGACTGTATTCGTCACGAGCAAATAGCTATCGTTCTTCGCTACGTGGACGACGACGGCGAACTTCGAGAGCAGCTCTTT
GATATTTTGGAGGTTCCAAGGGCGACTTCAAAAAAGCGCTCTGTTCGTCTTGGTGAAGAACTTTCTGCTTGCGAACGAGATCGACAGCGAGAAATGAGAG
GACAAGCATTTGGCGGCGCCTCAAACATGAGAGGCGAGTTCAGTGGGCTGCAGGCTCGCATTCGAGAGCAGGCTCCCCACGCTGAGTGCGTTCACTGCTT
CACACATCGGTTGAATCTGGTCATCGTCGAGTGCGCCAAGCAGTTGTCGTCGGTTGACGAGTTCGTTGGTGTGGTTCAACTGATGTACAGCACGTGCACT
GCCTCATGCCAGCGTGTGAGTGAGTTCGTGAGGTTGCAGCAGGACCGGCTCGCTCGCAGCGTGGCCGACGGACTCCCAGTGAAGAGAGGTGACGCCCAGC
TCAAGACGCTCAGTTCTCTTTCCAACACACGGCGGATTGTCGCGAAAGGAAGTTACTGTGCATCAAAGGGCACTTCAGCGAGGCTGTGGGGCTGATCGAC
TACGTTGTGGACAACGCGAGCACCTCGGGGAAGAAGGCTGCTGCCATCGGACTCCTTCGGCAGGTTTGTACTTTTTTGATTTTGTATTCCACTTGCACGT
GTTGTTTACGGTTCTAGGAGCAACGACGATGTTGTCAGAGTG