Description :
From Genome Similarity Track
Location :
Scaffold_1181:1306- 6178
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_1181-abinit-gene-0.13Conserved gene of unknown function

Sequence
4872 bases(100 bases per row)
GTTGATTCGCGTCACACGCCACGAGCACGTGCTGCAGCAGCATAAACGAGAGCAGCACTTCGCGACGTGTCGGCAGGAGCGGACTGGCGACGCCGGTCGC
GGTCGTGCCACGCGGCTGCAGCTTTTGACAGAGAAAGCCCAAGATCTTGACGGCACACGGTAGGCCAAACCGAGCGTCTGCCGAGATGGAGGGATCCGAG
TACACTGACGGGCTCTTGAAAATAAAGTCGACGGCCCGACTCAACACGCTCGTCGCCGACGCACGCAGCGACAATGTAATATGTGGCTACACAGATAGAT
CATTGTTAGAGGGGAACGACATCTCCAACGATAGGCTGGCTGGGAAGAAGCGTACGTCGTTGCGGTTGGCGCGGCTGAGAGCGTACAGCGCTTCAACGAG
TTGCCACATGGCGTGGTCCGACAGCTTGTCGGCCGCGGGACACAGCAGCACGGCCTGGAGCACGTGCACGACGAGCACGAGCACGTGCTGGTCGCTTTCT
GCGTTCGTCTCTTGGAATCGGCACTGCGCGACGGCATCTACAATGTCGGCCAGCATGTCCGGTACGCTCGCTTGGTGGATGTGCCAGTCCCAGCACTGTA
GAAAGTGCTGCACGGCCTCAAGCGCTGCGCCCGTGAGCGTGCTGCTCGTGTGCTCGTGGCGAATGAGGTCGAGAAACGGACGCAGCACACTGCTTGGGTT
CAACTCGACCAAGTCTAGTTCATACACTCGTCGTCAAGCCGCCCCTCCCATCAACACGGCGAGAGTATCACAACCGCACCTNNNNNNNNNNCTTCATACA
CTCATCGTCAATATCCGCCCCACCCATCGACACGACGAGAGTATCACAACCGCACCTTCACAGCGCAAGAGCCGCGCACGCAGCAGCGCAAAACTGTGGA
AGATCCCGCCCTGTGGTTCCTCCTGCATTCATTTGGCCACGAACCCACCAAAGCGAGATCAGCGTTTTCGTCCTCGTTTACCATCAATATTGGGCCGTTT
TGGCCCGGAAAAGCACGTACCTGGTCGCTTTTTCCGCCATGATGCACGAGCGTGTACCCATAGCGGCGCCGCGCGATGCTCAGGACGCTCTGGATCTCGC
TTAGCAGCACGGACCGCACGGCCATGACGATTCCGTTGGCCGCGTTATCTGCCGCGTCGCCGTGAGCTGGCTGACGTGGGGAAAGAACGAGGAAAAAGCA
GGGCGAACGGGAATGGGTTGACCCATATTCCAAGTAGGACCCGTGGGTTTCATGGACCCATCGACCTGGTGTTTTATACAGGTGTTGTATTGGTTTTCAA
CACATTGGAGTGGCCCACACGAGGAGCTCCCCAAGTGATTGGTTCGCGCGCCACGAGAGGATGCCCAAAACGGTGCGGAATGGCAGTTCCGAACTTGCGG
CCGACGCTGCGCGCGGGCGGACTGAGTACTGGTGCTTGCATTGGCTTGCGGATGGAATGAAGATAGTTTATCCATGTATCGTGAACAGATCGCAACGGGC
CGTTTTGGCGCGCGCGTCTTCCCATGATCATTTACAACCATTGTCATAGTTACACTGACCATCCCACGAAATGTGCTTGTTTCGATTGCAATGTGTGGGC
TGCGATTGCCATACTGCGTTGGCTGTTGGGCTGTAAGGCAAGGCGCTTGCGTGATTGCAGTATCCGCTTTTGTGTGTGTGTGTGTGGTTTGTGTACACCG
AGATGCTCGGGAAAGCGGCAATGCGAAAGGAAGAACTCTAGACAGTCTCACTCACAGCTTCGACCGGTGGGATCAGTACCAACATCATAGGATGTTCTGG
TGATAGCAAAGATCTGATCGCATCCGCGCTCTGCTGCTATACTACAGTAGCGATTTCCNNNNNNNNNNCGTGTGGTTTGTGTATACCGAGATGCTCGCGA
AAGCAGCAATGCGAAAGGAAGAAATCTCGACAGTCTCACTCACAGCTTCGACCGGTGGGATCAGTACCAACATCATAGGATGTTCTGGTGATAGCTGACA
TCTGATCGCATCCGCGCGCTGCTACTATACTACAGTAGCGATTTCCCCAATTTCCCAAGTTGATGGAAATGAACGGAGTGAGAAATGATGTACTTCAAGC
ACCCTCTCCACCTTCTTCCGGCGGAGGGCAGTACCAACGGCGCGATACGTTCTGTTGAAACATTCCAGCTGATCTCCTCCTGGTTTGCGTTAGCGTAGTA
TTCGATCATCATGACGGCACTGCAATTACAGTCTGAGGCGGCTGCTTCCCGCCGTCGTTGGCCCGACGCCTGCCGAGAGAGTTGCCGACAAACTGCCGTC
CGACACGTTGGACATTGTGCTCTTTGTTCGGATCACCACGGACCGGCGGCCCACGAGCGTTGTCGGTACGACGCGCGGCAAGACACTGAACACGTTCCAT
CCTTCGAGTGCCACGGCCACGCCGCTCGTACCGGCCTCGGCGCGCATCGCGTGAACCGACTGCAGCGTCTTGGTGCATAGCTCGTAGAATTCGAGGAGAT
CGTACTCGAGCNNNNNNNNNNTCGACTGCAGCGTCTTGGTGCACATCTCGTAGATTTCGAGGAGATCGTACTCGAGCGGATCGTCCTTTCTTAGAGACAC
CGGATCGTTTTTATCGGCCTCTTCCATCACAGCTGCCGCGAGTGGGGATCCATTGCCCCGTGCTGTTGTTACTGGCGTCGAGACGGCAGAGGAAAAGGGG
AATGTGGCGGCTATGGACGACTGGCTGGACGAACCGCGTCTGGAGCCGCTCGAGCTCTGCCTGTCATCTGCGGAGGAGAGCCCACTGCGCAGTGGTGTCC
CACGAGTCCCAAGACTCGAGCCAATGGGGAGTGCTGCACTGGCTGCGACAGTCGCTTCGACGAACCGAGAGTCCGCAAACTCACCACGGAATGAATCGCT
GATACTCTTCCACTCGGTTGCCAACGCACCCGCAGAGGAGACAAGCCTGTGGAGCCGTTCGAAGGTGCTGGGCGAGACCACAGTTTTGAGCCATGCATTG
TCGTCGAGCACACTCTGAAGACTCCGAAAGGACCACGAGAGACTGAGCTCTTTGACCGAATCGATGAGAATCGCCACTCGCTCAAGCCAGTTGATCCACG
CCCGCAAGGCGTCGCGATCCGAGTCGACGTATTGAGGCACCTCACTTGAGGAGACTTTTCCTTTCTCCTTGTGCTTGTCTTGCTGCTGTTGCTGCTGCCT
CTGTTGTGCCTCCATGAACTCGCGCTCTTCTTGCTCCATGACGAGCTCATCATTCATTTGCCTGGCACCCTGTCGCAGGATCTGCCCCCACGCCTGGCGG
TTGAATCGCGCGTCAAGCTGGCCGCGACACCCCCACTGCGAGCCGACGACGAGCCGCTTGTTCGTCAGTAGTTCTTCCATCGTGTGGCTAAACATCCAGC
GCATCGTGAGCCGCTGGAGTAAATGATCAAACTGCATTGACGATGGCAGCTGCAGGCTCTGCATGACCTCGTAGAGGTCCATCTCCCCGGTAAATAGAAG
TACGAAACGAACCACGGGCGGTGCGCCTGCCGCCGACGCAGAGCTGCCGCCACCGGTCGCACGAAGCTGCGCCTTGGACGGGACCGTGGTAAACCACTTA
AAGAAGAAGGGCAAGAGCTCGAGATGGTCTTTGAAGAAGAGCTCGATGAACCACGACAGCTTTTGGCTGAGCGCCTGGGCGTCCACCTCTGAACTCATGG
CAATGGGTTTGTCTCACTTCAACCACAATGGAGAGACTCCAATCACAACCCACCTCTTATACCAGGCCGGCAGAGCAAGTCAACGAAGAGAAAGCACTCG
GCACCACGCTCCAGATACTTGAGCTCATGAAGCGTCGCGGCCGCTGCAACAACAAGGCACGTGTTAGCGAGCCACCACAGTAATCAAAAGGCGAGGCGAG
ACAAACAGTCGGCGTCGCTGTAGTACGTGAAGTTGATGGTCGAGCGGGTCGTAAACGACGAGCCGACGTCCACTTTGAACACGTGATCGCCGAGCTCGCG
TTCTGGTGTCGACTGCAGGCAGCTCGCGCGTAGTAATCCGGTGCGAGCGGCCTTTCTCGTCCAGTCGAAGAACGACGCAATTCGACGCTTCACGTTGCGA
AGCAAAGCGTACGATCGCAGCCGCGCAAGGAGGAAAAAGCTCCGCCATCTCTACAGCAAGTTATGTCCCGTGAGAACTTTATAGTTCCGTTGGCATGGCG
TATCGTTGAGCACGCCACGTACTGTTCGCTCCACGGGCATCCACGCTGAGAATACCAGAGCGAGAAGCCCAGCACGACACACTCGCGTGTCCTCTTCCAA
CGCTGGGGACGTCAGTTGGATTGCCGTCTTTTGCTTGTACCCAAACAGTCGAAGCGCTCGCTTCTGCGCCAACACGAAGCGATGGCAGCGATGAAAGAGC
CGCTGCAACTGGACGGTCTGCCACAGGTCGCGGTATGTCGCCACCGTCCCACACTCGGCCAGGAGGAATTGCACGTACTTGAGTGGCAACACGTCGTCGC
GACCAAAGTACTCCCCGACAAGCTGCAGCACCCGCCGCACTTTCTCCACGACACGCCACTCTAGGCTCACACCCATCGCTTGGAGATCGTAGATGAGTGG
GTATGCATCTTCAATTGCCTCGCGGTATCGCAGGAAGCCATCAAACGTGAGGTGGTGCGATGTCGCGTCTGTCACCAGCACATCGTTCGTATACATTCGC
CAGACCTCTTCGTTGCCGCTGATTGCACACATCTCCGGACGCTCGCCCAGTCGCTCCTCGATCACCGTTCTATACTCTACGAAATCCGTATAGCTCCACA
GACCGTCGCCGTCGACATCGAAGAGCTCCCACAACGCGCGGCATTTCTCGCGGCCCAGGTCGTTCACACACC