Description :
From Genome Similarity Track
Location :
Scaffold_1931:1306- 2908
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1931-snap-gene-0.1Carbohydrate-binding protein

Sequence
1602 bases(100 bases per row)
TCCCTAGCTTTGAAGTACCCGCTTTTGACTATCGCCACTTGAGTGAGGGAGACACCCCGGACCGCGTGCTTCGAACGCTCGAGCAAGGAGGCGTTCTCGC
GCTCAAGAACATCCCCAACTACGCCAGTCTTCGCGAACGTTACCTGGAAAGTGCAGTGAGGTGCACACTCGCTTCGGACGAACGTGGCACCGACATCCAC
ACATTCCTGTCCACGAAAACGTTTGCGGATGGCACGCGTCGTCTCACGTTGCGGGCGAATGCTGGTCTGGAATTGGAGAGCTCCGGTACCACGGAGAACG
CCAGAGCTTTGGAGAGCAATTGCCCCGGGTACCGCCAACTGCACTTGGAATTCAGCCGCGCACTGGAGCACGCAGTGAACACATTTGGCGCCGTTTTGGA
TCAGACTTCGTTCAAAGTAAGCGACGGCGAATCGCCAATTTCGTCGCGGAAACTAATCTCCGAGTCTGTTCGGTTGGACCATTTCCACACGTACGAGTCG
CCTTCTGACCCTACCACCAGCCGTAAACTGTCTNNNNNNNNNNNNNNNNNNNNNNTGGAGCGCGAGCTGTCTCTGCCACTGCATGAAGACCATGGGCTAT
TCATTGCGATGGTGGCTCCAACATTTTTCACCGTTGCAAAGGATGGCCAAGTTCGAGCGCGACATTTGGCCTCGAATGCATCTGGGCTGGTCATTCGCAG
TGCCGATGGTGAGAAGGTCGTGCGTCCAATTCTGAAGGACGACGAAGTGGTGATCATGATGGGCACAGGTGCGTCGCGCTGGCTGCAAACCAGTCATCAC
CTTCCAGCGGTCATGCACGGCATGAAAATGCCCACAGAGCTTGTTACGTCGAACGGAGAGGAGCGCAATCTGCGTGCTTGGTTTGGTAAAATGACGCTCT
TGCCTTTCTACCAGCGACTCCTGGAGTCCCGCAAGAGTTTTGCCGAGTTTTCGAACATGACTGCACGTCACCTTCTCGAGAAAAATGCAGGCGATCTCAA
GACGATTGGTTGTGCGAGCGGACGCCACCTCGTGGAATCGGAAGGTAGCTGCACGTACAAGTTCTGCACGATCAAGCCTGAGTGGGAGTGGAACCCGCCG
ACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCGTGTAACTACAACACGCCGTTCTTTGACGAAAAATGTGCAAGAAAATGTGATTGCGTCGG
TACGACCACACAGGCAGACGATTGCTGGATGCTCTGTGTTGCCAGACTCCCGACAAGTGAGTGCGCGTTAGTAGACCAAGCGTGTTCGGGACTCAAGATG
ATCTGCACGGCAAGCAGCACAACACCAGAACCAACGACTGAGACTCCTACTTCACTTCCGACACCAGCGCAAACAACTGCGGCTCCTACTCCACTTCCAA
CAACGACCGAAGCACCACTGACCCCAAGACCAACGCCAGTATCCTCAACAGTGACACCAACTCCTGCTCCTTCTCCAGAGCCAACCACCACAGCTCCAAG
TCCTAGTGCAACGCCTACGCCGACGGTCGTGACCCCTGGTACTCCAGAGGTGACAACGACTTTGGCCCCAACTCCTACCGCTCCGTCGACTGTGACGCCA
AT