Description :
From Genome Similarity Track
Location :
Scaffold_825:1306- 2863
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_825-fgenesh-gene-0.1Gene of unknown function

Sequence
1557 bases(100 bases per row)
GTCGTTGACGAATCGACTGGTTGAGGCAGCTGCTTGAGGCTAATTCACAGGCCCATGATCTGGGCCAGCGCAAGAGTGAGCGCGGGTTCTCCGAGAGCTG
CTCTCGGCCTCGCTTGCGATCTTCAAGGTGCCAGCACTTCCCCTGTCAGTGACAGGCTGCAGTCCACCGTGCAACGTGTGCAATCATGTCAGGCTGAGAT
GATTCTCAGCTGTACCGGGACCACGAAGATCGCTCAGTACAGTACATGTACACCGTACTGTACACATGCTCCATGCCGTGGAAGCCAAGTATGTCGCCGA
GGAGCAAGTCGTCGACGCGCAGCGAGTCACGGCATATCGATGTGCATGTTGTTTGTACACACGGTATCCAGCAACGAATGCCCGCTCGTGTCCATCcTCC
CCGATGGAACGAGCAATGCATCGACTGACCCTCGACTGATTGACTAAGGCTGAACACACACTGGAATAGTTTAACTCAGCTCTCCACACATACTAAACCA
GCCCAACCCAAATCAAATAGAGACCAAACCAGCCCAACCTAATTGTTAGTTGTCTGACAAAGCGCTAGCCCAGCCTAATCGCTTCAGTCAATGGTCTTGG
TGGGCATTGGCGACACATCGGCCACTCGCGGCGTCGAGATGGCGCCGTAGAAGACGCCTACAGAGCTCAGTGTCGTCGCCCCGAAGGTGCCGTGGAAGCC
GCACACCTGCATCGTCTGCTGCGGCGCTACGAAGCGGTGTGGCTCGGCCAATTTCGTGCTCTCGTCCTCGCTCTTCGTGTCTGAGAGCTTGCCATACCAT
GGGCTCTTGGTCAGGTTCGTGCGGAAGCGCAACGCATTGACTGTcTCCCTAGCGTACACTTCCATCTCCACAATGTACTCGCTGTGGCGAaGGAAAAaGA
CGTGCTCGTACCGAGGCAgCGGcTCCTCGCGCTTGGCCAAGTGGCGACCATACATCTCCGAGGAGAGCACATGCAGGTCGGTGATGCCTCCcGTTGCGCC
ACACTTGACGACAATCGCCCGCACTTCGTCGTGCACTTCTGCAAACTCAGTTTGAACGCCATCACCTTCGTGACCACCCGCACCGACACGAGACGACTTC
TCTTGTGCCGTCAATGACGTGTAAATGCCCCGCACCAAGTGACTGTCGGTTATGGGGCAGAGGCGGAGTCCTAGTTCCCAGCGCCCAGTCTTCGTGTGCA
AGTCTTCGATCGCATTCACGAAATAGCCCTGTGGTGCAGTCACACTCTTAACGATGCCATGGCGTCGGCCAAACCACTGTGACTGCCGCTGGTTGGTTTG
GAGACGCAGCCCcAcGATTCGAAGATCCTGCCAACAGATATCGATACCACGGACTAGCTCACCTGGCCCCAagACGAAGAGGTGGTGTGAGGCGTCGTTG
CCCAGTGTTGGACGGTTGaGGAAGCGGTCAAaGAGATGCGTtGTCACTCCTCGAAACGCCAAGTCAGTCTCACCGATGGTCCCGTAGATGGCAGCGAGGT
CGTACGTCAGTGCTTCCcACGAGTTACTCAGCAGTGAGCCGCtACCGTTGATGTGGT