Description :
From Genome Similarity Track
Location :
Scaffold_238:13057- 14874
Transcript NameFunction/comments
Albla_Nc14105550Phosphatidylinositol 4phosphate 5kinase (PIPKD12/GPCRPIPK) putative

Sequence
1817 bases(100 bases per row)
GTGCAGTTCTTCCTTCTGGGGAGTACATTGTGGTATTTGATGCTGGCGGTTGATCTTCTGTTGGCGCTTTTCAACCCGTGGATCGGATATTCGTGCAAAG
CATGGACTTACCACATTATGTAAGTGAAGTCTTTGTGCGTATCGATGATTTTTGTCACACCAAGTCTATCTAGAGCCTGGGGAATAAGCACTTTAACAGC
GGCCTGGATGGTCGTAACAAAGAATGTCGGCCTATCCACGTGTAACATGTGCTGGATACGCAAAACCAGTACTCCCGAACAAGTGAATTTGGCGCATTGG
ATGTTTCTATTTGGTCCAGTAATACTCACTTGGCTCTTTTTATTCTTTGTCTTGATTTTTGCGACCATTCGATTTGCCCAGCGTCAGCTGGATGTCACTT
ATCGGGCCAAACGGCGGAGTTTATTGCAGTATTATCGCTATTTGTTGTTATATGGCGCACATTGGGCAGCCTGCGGGTCCATTTACTATGAAGATTATCA
CGATTGGTTTGGACATTATCGTAATCAAAGGCGTCTTCTGATAACACTGGTGATCGTATTTGCCTCGTATCCTATTCTATTGTCCATTGTGTGGGTCGTC
AATACAGATCTAATCCAACATTGTACCAAGGACAACACTCTTCCGAAAGCAGACAAAGGACGAGAGGCTTTCGCGAATACAGATCACTTCAGTGCTGCCT
TGCGAAAAGATTTGATGCGTTACACCACAACCGGTATCCGCTGCAGTTTGCGGGGAGATTCAGTAGACACCGTCTCTAGATCTTCTAGACTTTTAGAACA
TGATCTCGAAAGCAGGCCTTTGATATCTCCGTTAGCGTCAACTTCGCCAGACCTGTACCACGAAAAGAAGCGCGTTGCAGCCACGATATACAATGTCGAG
TATCGGTTCTATGAAAAGCTTGGATTCACCGATTATGCGCCTCGCATTTTTCAAAGTATACGTGAGCTCAGTGGCATTCGGCATGATTTGTATGAGCAAT
CGTTTGCAGACACGCTCCTTGAGAGAGCTTCGGAAGGAAAGTCGGGAATGCTGTTTTACTTCACAACAGATCGTAAGTATCTCGTGAAGACTATGACCAA
GATGGAGCACAAATTTCTTTTGAAAATCTTGCCAGTGTATCATCAGTACATCATGAAGCAGCCAAAATCATTACTATGTCGATTTCTCGGCTGTCATTCT
ATGCAGCTTCCTGTGGGGTGGAATACAATGTTTTTTGTGGTCATGGAAAATGTCATGGCTGGCGGTAAGGTGCACGAACGATATGATCTGAAAGGTATCG
TCTCGGCTGCTTTCAAGAATAAGGACTATGTACGCCAACACCCATCAATAGAAGCGAGAAGCCAGCTTTCTCCGGCGCTCTCTATCGAGTTCTCCCAAAT
CTTGTCTCGGACAAGCTCCGATGTTCAATTAGGGCGAGATCAAGAGCTCTTATCCAGACATGTTGCTCTCAACGTGAATGCATCGATCCGAGCGAATTTC
TCTCGTCAAATTATTAGTGACTGTGGGTTTCTACAAAGACTGGGTATTATGGATTACAGCTGCTTGTTGGGGATACGACACTACAGTAAACCGCTCCGAG
AAACCGAAATGAACGACCTACCGAGGAATGCTCTCATCTCGGTGGATTATCGCTCTGTGTATTATGTCGGTTTTATCGACATTCTCCAATATTATAATAG
CGGATGGAAGTGTCAGCGGGCTATTTTATCGCTCCTTATAGACCCAACGGAGATCACTGCATTGCCACCAGCAGAGTACGCACTGCGGTTCTTACAATTT
ATCCACGATCATCTGCT