Description :
From Genome Similarity Track
Location :
contig_75:130547- 137460
Transcript NameFunction/comments
g12343.t1hypothetical protein
g12344.t1hypothetical protein

Sequence
6913 bases(100 bases per row)
CGAGAAAACTCGCTGCGGAAGGATATCCACTTGTACAACAAGATCATCCTCTCGGGGCCGGCCGACTACATCGTGCTCACCGCGAGTGACGTTCGGGACA
ATGCCTCCGGTGCATCTGATCGTCTCCACTGGGCCAAGATTTTTGGGCTGGAGAGGTTTGCAGGATGTCTGCGGCAGACTGTCTTCGAGCCTGGTGCGAT
TATTGTCCAAGAGGGCCACCAGCTTAACTCTCTCCATCTCGTTGTTGAAGGCGAGTGTCGGGCCTCTGTTGGGCGTGACGACTCCAATAGCCCAAGCACC
GTTCAGCCAACCGACGCCAACTCAAACAGCACCAAACCACCACTGACGACTGCAGAGGCTCAGCTCCGGCACACTCGAAAATTTCGCTGGAGTGACGATT
CTCAGTTGCCTGTGGCCTCGCTCGGACCAAAGTCCACGATTGGGGATATTTCACTCATGCTAGGAACCCCAGAGCCCACCACCGTTAGGGCTGTCACGAC
AGTAAATGTCCTCTCGCTTTCCCAGGAAGACTTCGTGCGCGAGAGCAGTGACCGACATGATCCAGCTATAGCCACTTGCATCGAAAGTAAGCATCGCAAG
CCAGCTTTGATACCTGTTGTCTCCGCACGCTAATTGCTGCACTTGTCTAACGATGCTCAGAATTGCAGAGCACAGCGTACGATACACTGCGATTCGTGCT
GGAACGTGTCGAAATTGAGTCCAAGAACGAGCACTGCGACCAGCGTCTCAAGATCGATTCCTTACGCGAAGCACTGCGCCAGAAACATCCAGGTATCTCC
CCCCCTGGATCATACGCATGTTACTGCTTTGTACTGCGACGTTCACTGACACACCGATGTGATGCAACGCAGTGATGACGAAAGACAAGCAGTCGACAAG
CACTTCTTCGGGTTCTACTGCAAATACGCACAGAGCCTCCAGTACATCTTCTCAGCCTGAACAACCAGAAGCCATCAATGCTGGAGGACAGTGCTCTAGC
GTCGTATCTCTGCCATCGGTAGTGCTGAAGCATGCCACAGCCAGTGCAGTCACGAGAAGGCAACACATCCGTAACCAGCTCGGGACTTCCGTCGCTGCCG
TTGCGGGAGAAGACGTAGGTCCACTCGAAAGCTCCACAGGAATGACTCGGCAGCAACGCAAAGCAGCGCGAGCCTTTGCGAGCCTGCAGTTCCCTGTGGC
TGGTAAATGTCTCGGGGACTGCGTGAAGACGCCCAGCAGAGCCTCAGTTGACGAGTCTCCCGTCACAAGTCCAGACTTGCAAGCCACTCCGCAAACCGAG
GACCTGCTGTTTTTGTTCCCCACGATGACTCAGCGCCGACAACTTCACGGAAAGTACGTAAACCTTGTCTTGGTCTGCCTCATCGTCACTGATCCAGCTC
CATGGTAATGACAGGAATTTACCACTGCTGCCTCGATATCGAGGCTTCGATGCTGTCCCAACAGAGTAAGCGCTTCAGCTGCTCCTTCATCAGATAGTCT
CGTACAACCCTGTACTGCACAAGCAAGATCGGATCAAACCAACACAAATACAATTCGCTCTCCGTTACTGGGCAAGCATACATGAATTACCGAACACAAG
TACCAATCTTCGCAGCGGCGTCTCACTCTGCCTTCACCTCCTCAGTCTCACGATCAAATAGATCTCAGTAGGCCTTCCTTTTGTCATCATTTTTGGTCGG
CGGTCGCGAAGTCTGGCCCTCGAATCTTGGCGTCATCAGCAAGGGCAACTGAGGAAGTGGCTGCAGCATTGTCACTCGGGCGCTCCGTTTTCACCTTCTC
AAACGATGAGGTTTGCTGTTCCATGGGCTTCTCACTAGTCTCTCTCTCGGACTCCTTCCGGTGCTCCTGCGATGTATCTAGTTTCACCCCTTGCGTGACT
GCTTGAGCGTTAGGCTTTGCAATTTCTCCCGTCATGGGGTTATCTTCCTGTGAAGCTGATGCAAGCGTCTTCAGAGCCGTTAGCGTGGCCTCATCGGTAG
ATGTCTTGCCCCCCGCTGCATTTACTGTGTCTGTCGTTGTCTTAGCTTTCTTTGCAGCAACTGATTCATCGGCAGCCGCAGAGGATGAAGACGGCGATGT
TTCTGATACCGCGCTGTCATCCTCAGATAAGCCACGAGCACGCTTCTTCAGCAACGTGGCAGACTCCAAAGCCTTCGTCGCATTGCCCATACGAGCATCA
TCGGACGAAGCACTGGCACTGTCACTCTGCTCAACGCTTCCAGAGGAGGCTGGCGTCGCAACCTCCTTTTTCACATCATCGTCTTCCTTTGACTCTCCCA
TCAGCTCGTCGTCATCGTCATCCATCGAATCGTGCACGGGCGTTTCATGCACGGGCGATCCATACACGGGTGTTGCCGACGGCGTGTCTACAGGTGTAGC
ACTCGGGGACTCATCGTCATCATCGTCGTCGTCTCCATCTTCATCCATGGAACCCAGGTACTCAATAGCCAACTCCGGTTCAAAAGCCACTTGCTGGACT
CCGGGGCCCTTACGCGTGGCGAGGGCGCCCAAATCTTAAATGGCTCAGAGAAACCGGACGGAGTGGAGCCACCACGGGCTTCCAGGGGTGTCTTGCGCAG
CACACCAGGATTGAACTCGATGCGGAAAGCACCTTCACCTTCGAAGATGGACTTCGTCTTATTGAGGTAGGCGGCGGCCTTGGCTTCGGCGCCTGCCGGA
TCTGCTGAGGGCTTTGGCTCGCCCTGCTGCTCCCCAAACGCCTTGGTGAGCTCTTGGCATATGTCGTCATTTGCCAAGTGCTGCATCTGTTTCAGCACCT
GAGTCACCAGCTTGTCCATCGTGAACAAGAAGTACGACGTAGATCCCATGAGACTGCGGCAGGAGTCCTCGTACTTGGAATTATCAACCGAGCCATCGAT
CAGTGAGTACAGCTTCGAGAGGAAAGCCTGGTAGTCGCCGGTCTTCTCCTTGGTTGAAGCAGATAGGGAGTGGTGTGCGTGGGCAAGAGCGCGCGCTGCC
GGGTTGATTGTACGACGGTTGCGGTTGCGTTTCGCCTTCTCGCACAGGTCAAAGGCACGCTCAAGACGGTTGTGAAGCATTTGGTACAGACGCAGGAACG
CATACGCGTGCTGGTTACCATAGAAGCGAGACTTGTAGTCAGCTTGCACCTTAGCAGCATCTTGCTTGCTGTCGAGCGCTGGGAGCCCTGGAGGGAAAGC
AGCAGCCTCCTGGATGGTAATGGCACCAGGCTGCAAGTATGCCTGGCACCCAATGGTAGCCAGGTTAATCGAGAAGTAGCCCTTCGCCTTGTTAAACTGC
TCCACGGTACCCTCGCCAAAGTCTGTGCTCGCCTCCGTACCCATCGGCAAAGTCTTGGCTTTCTCGAGCGTCACAGTAGTGCGCTGAGGCTTGCGCACGA
GCCACTCCTCTTCCAAGTGGAAGAACGGGAAGAAGAAAGCCTGCCAAACCTTGGAAACTTTTTCTTTGTCGGCCACGCTCAAGTTCTTCTCGGCCGCATA
CGAAAGTAACCCGAACGCCTCCTTGTGGATCTGTACTGAAGCAAACTTGTACGCAAAGTGCGGCTTCCATTTAGCTGAAGACGAAGCCTGCGCCGAAATT
GCCGCCGCCTTTCCATCTGCCGCAATTGGAGCCTTTGCTGAATGTGCAAACTGCTCCTTCTTGAGCGCATCAGCAATATCCGATGCCTGAGGAGGAGCCT
TAACGCTGGCAACAGCAACAGTAGCTGAGACAGTGGATGGTGCTGCGCTCGAGTCCGTCTTGGACTCTTCCGCGCGCTTCTCGTCTGCTTCCAGCTTCTT
CTTCGCCTCGCTGCATCATCATCTTCATACCCGTTTGCTTCTTGTCTTTCTGCTTGAAGTAGAAGCTCGAGTGGTCCAGCGACTTGTGATAGTTCTTTTC
ATTGACCTCCTTCCACTGTCGGTTAAGGTCTTCGCGCGCGCGGCGCCATTCTTCGTCCTTCTGCTTGAGGCGCTTGAGGATCACGGGAATCGCACCCGCC
GGGTACTTACGCAGCAAGTCCAAGATCTGCGCCAGAATCGCCGTAGATGCGCGTGATAGCATTTAGGTGCGTGACACGGAACGTACCCTTGTCCACAACA
TAGTTCCACAGCTTGTCATCATCGCCACTCGACTTCTTGCTGTTAAGTACCTCAATCTCGTGCGCAAGCGGTTCGAGAATGCTAATGGTGGATGCATTAG
CCTCGATCACCATATCGATCTCAAAGCGCTCGTCTTCGCACTTGAACAGCGCCTCCTCGTACTGGTTCTTGCGCATGCTCTTGAACGAGTAATCTTCACT
GCCCGTAGGCACTGATACCCAAGAGTCATTGCACACTCGCTTTTCGAGCGCTGAGCGGTGAGAGCAAGGCGGAATTGGATAGCTTGCGGGCAGACCACGG
TACGATGGGGTAGCGCGGCGGCACTGCGACAGGTCCGTTTCCGCCAGAGGAATGAATGGCCAGATTTCCTTGGGCGTCTTTTGCACACCATGCGAGCACA
GCAGGTGGTCGAATTCTTCCACCAAGTCCGTGTGACGGCCAAAAAGGTTCCTGATGAGCGATAGCATCTCGTTGCGATCCAGCACTTCCTGGCTGTACAG
CTCAAGACACTTCAGGAACTCGCGCCAGTTGTCGCGGGACGGAAGAATCTTCTTGATCTTCTCAAAAATATTCCACTCCTCCTTGTCGAGCAGCACGTCC
GAAATTGCCAGGTACGCACGGCGTTCCTTACCGTCGTACGGGCGGCGCTTGGCGCGCTTGTGGTTGAACTGCGCACGGTTGCGCTCGCGTTCGCGCTCCT
TCTCGCGGCGCTCCAGAGCCTTTCCACTCAGGCGTTGGTCATCATCCTTGTAGCCTCTTCCCTTCTTGCCGTATTTCATATAAGCATCCTCGTCATCTCC
CATTAAACGTCCACCCTTCATCGCAGCACTGGACGGCGAGTCACCTCCACGGTCATCTCGTCGGTCAGACTGCTGGTAGCCACCTTGGCCAAACTTGCGA
GCCTTCAGTGCCATTTGATCCTTGCGCTGCTGAGCCTTCTCGGCAGCACGGTTCAGACGCTCCTTCGCTTGCTCCTGGACCGCATCGGGCAAGAAGAAGG
TAAACTCACGCAGCAGATCCGGGTGGTCTCGGAAAAGGTGCGAGACTTGGTCCAGCACCTGGCGGATGGAGCGCTGCTCCTTCTGGTAGGTATGCAGGAT
GGCCAGGAACTCCTTGTACGTCTCAGGCTCATCAGCAAAGCGTTGCTTGATAGTGGTCACGTAGTGGATCGCGTGGTCGAACTCCACGGGGTTCGTCGAG
CTCCGTGACCCCCCGTTGCCACCACTTGGCGTCGGTGCCTGCTGCTGCTGCTTCTTCGGCTTCCCACCAGTCTTCATCTGGGCAGAAGGGGGCAGCTGCT
GACGCGACGACGGCGTCGGCTTGTGAAGCTCCGGGTGAATACGGCGGCGGAGGGATCGTCACCGGCGGTGGGCGGTGGCCCATGTTGGCGTTCGACGACT
GCCCCACTCCCGAGTACATAGACTGCTGCACACCTCCACGCCCCGTCATCTGCGACGGGATCACCTCAATAGACGTGTCGGGGCGAATACGATACCCTGG
CGGCAAGAACGTGTTAAAGCCCAGGATCAGGTTGGGATAACCGCGGAAGAGCGTCGACACACGCAGGATGACGCCGGGCGTGTCGATGGCCTGCGCCTTA
AAGTCCTTCATGACGTCCAAGAACTGGTTGTAGATGTCAGGCTGGTCTCCGAACTGCTGCTTCACTTGGTCCAGATACAGCAGCGCGTCCTCCACACGCA
GCTCCCGATGGCGCGGGGGCGGACCCGACATGGTCTGCTGCTGCTGGTAGTAGTCTCCCTCAAGTTGGTCGTTGGGGATGATGCGTCCGTCCAGTCCGTA
CTGCTGCTGAATCGGCACTTGTTGCTGCTGCTGCTGCTGCTGTGGATCCGGTTGACGACGAGGGGGCGACTGCGGGCGCACACTGTAGCCCTGTGTGGGC
GGATTGAGCCCCCCGGAGGACGGAGCCATGGACTGCTGCACGCTGCCCATGCTCTGACTCAAACTGGGCGCCTGCATGCGAACCGAGTGGCCCATCATTC
CGGTGGCACTGGAAGGTGGAGCCCCCTGTGAGCCCACGGGTTTCCCCAGCACGGAGGGGGGGCCGCCCGCACCGGAGGATCCTCCCAAGGTCCCGCGGGG
CGGGTGGAGGATGGAGCCCGAGAGCGGATGCGGCGAGCGCGACGAGTTGGGACCGCCACCGCCCAGTGACCCCTGAAGGGGCGGGGGAGGCAGCACAGGC
CCTCCCGGGTGCATCATGGAGTGCTGCGGCTGTTGCTGAGGCTGCTGGGAGCCGCCGTGCAGTGGGTGCAGATGGCCGCCGTGCGTGAGCTGCGCCAGCG
ACGGCTGTGGGTGGTAGCTGTGCTGCTGCTGCTGCTGGCCCGAGGGAGGGCCACCCTTGCCCCCCAAGCCCGAGCTGGAGGCCGAGCTGAGCGACGGAGG
CCCGTGGCGGTCCCCCGAAGAGCCCGGATACGATGGATTCATCGCGAGACGCGGCGAGGGCTTCGCTGGGTTTGGCGCTTGTCGGCTTCGCCGGTTCTTT
GGAAATGAGCAAGTGGACGGCCTGCTCAGCGGCGGACCCGTCCACCCATGCAGCCAATAGCTGTCGGATATTAGTGGAGGCACTCGCTACGTCCTATATG
ACGTTCACTATTGACTAGATTAACGTATTTAGACGGAGTATAACGGTACATCATAGGATGCCCGTTTCTCCGCCGAGCGATGTTGAAGCTAAGTCGAAGT
TAATCATGGAGCAGAGCGCGCGAAGTCCTCGACGCACCAGCGCCAAGCGGAAGGAGAAGGAAAAGGTAGCACATGGTGGTGTGAGCCGCAAGAAGAGCGT
TGTGGCGCCAGGT