Description :
From Genome Similarity Track
Location :
contig_43:130523- 132271
Transcript NameFunction/comments
g7474.t1ETL82456.1 hsp70-like protein [Phytophthora parasitica

Sequence
1748 bases(100 bases per row)
CGTGGCAGGAGTAGCTACCTCCTCCAGCTTCTGCCTCTTGACGTCAAACGCCTCCTTTTCGGCCGAGTGGTTGCCGTTCAACCAATGCAAAGTGTCCGTG
GCACTGTCTTTGACTGCCTGCATATCCGCGATAGAGCGTTTGAGCTCGGCGATATTCGCAGTTGCAGAGCTGCAAACAGTGTTTGCGTAGCTTTCCAACG
CTGTCTTGGACCCAAGGCGTAACTCTTCACGTGCATCGGTGCCAATCGAGAGATTCTTTTCTAGGCCAGTCGATATCTCCTTGACCGATACATTTACAAT
GTCGTCCGCGTTAATGTCGAGTGTTACCTCGATCTCAGATTCGCCGCGCGGCTTGAGCGGAATATTATCCACTTCGATCGTCCCAAGAAGGCAGTTGGCA
CTCATATCTGAATGCTCTCCTTCAAAGATCCGAACGCGCATGACTGCCTGGTTGTCCTCAGATGTCGAAAACGGTACCGTTCTCTTTGTTGGGACAGTAG
TGTGCCGATAAATGACCACCAAGCTGTTTGTGCCGTCTACCTCGGCCCAGAGCGACAGCGGGGTTACATCCAACATAATGAAGTCATATAACGTCGGAGA
AGCCACGCAATTCAGGATGGCAGCTTGCACAGTGACACCGAACGCTGCACCCTCATCAGGACGAATTGGGCTCGAAAGTGCCTTGTCGCTGAAGAAGTCC
TTCAGCAGCTGCAACATCTTCGGACTACGCGCGGAACCACCACCAACAACCACCTCACGAACTCGATCCTTTGCCACTCTGGCATCTCTCAGCACCTTTT
GCACAAGTTGCAAGGCCTTGTCAAAGAGATCAGCGCTTAAGTTTTCCATCTCAGCGCGTGTGATCGTCGCGTAGTAGTCGATCCCGTCGTGCAGCGCGTC
CAGCTCAATGTACGTCTCCGTTGAAGACGACAAGGCTCGCTTAGCCTGCTCACAAGCCAAGCGCAGGCGAGTGATTGCACGCAAATTCACCCGTAGATTC
TTGTCATGAACTCTCTCAAAGTCGGTCACGCAATGCTCGACAAGGCGGTTGTCCAAGACCTGCCCACCCAGGCGTGCGTCTGTCACCGCGGCCTTAACTT
CGTAGATGCCCTGCTCAATGGTCACCACGGACACATCTAACATCCCGCCTCCCAGGTCGAACACCAGCACATCGTGCTCGCCGTCTGTCCAGTCCTTGCC
GAATCCATAGGCGATAGAGGCGGCAGTCGCAGGGTTGACAAAGCGCAACACGTTGAGCCCAGCAATTTCTCCCGCGTCCTTCATCGCCCGCCGTTGCGAT
GGTTGAAGCAGGACGGTACGGTCAGCACCGCCTCCTTCACTGTCTTGCCAGTGTGTTTCTCTGCAAGCTCGCGTAGTTCGGCCAGCAGCATGACCAGGAT
CTCTACAGGCTGGAACGTCTTGGTCTCACCTCGGAATTGCACCTCCACCTCGGGGTTATCGTTCTGTCCACAGATCACTTTGAATGGCCAATGTTTCATG
CTTCTCTGCACTTCTGGGTCGGAAAACTTGCGTCCGACGAGTTGGTTCATCCCAAACACGGTGTTGCGAGCATTCCTTATCAGTTGATACTTGGCGGCGT
GGCCGATCAGCCGCGAAGTCTCCGTAAATGCCACGTAGGACGGCGTCGAATAGGACCCATCGCAGCTCGGGACGATCTCCACGCGGTCGTTCTGCCACAC
ACCTACGCGCGCGAACGTCGTGCCCAAGTCGATGCCCACGACTGGACC