Description :
From Genome Similarity Track
Location :
Scaffold_33:130522- 134664
Transcript NameFunction/comments
Physo_134639reverse transcriptase
Physo_134640pol protein

Sequence
4142 bases(100 bases per row)
TGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGGTAACGTA
GGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCACCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTC
AGACCGTAATTGATGAGGAAGGTACTCCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACGCAGACCATAACTGATGCGGGAGTCGCTGG
AAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCG
GGTAATGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGACGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAG
TCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCG
TCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAAGACTTCTTGGCCGAGCTA
AAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGTTCATGGACCAGGCAGTCCTGGAGAAGT
TCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTCCAA
GGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCC
CGGGATCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCATGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTG
TTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGATGAACTGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTT
GCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCGTGTGGACGGATATTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCT
GTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCTGGCAACGTTCAATCGCTTGGTCACACAACTGTTCC
GACCATTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTTGTCTACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCT
TCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGTTGTACGCCAACATCGACAAGTGTGTGTTTGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTC
AGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTAGGACAGTGGTTGGGCCTCG
CCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCA
TCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGCCCTGGTATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCT
GACTACGCAATTGACTGTGCGCTATTGCAGGCCAACGATGAAGGCCGCGAACGGGTCATCTCGTCCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACT
ATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACACCCTTTGTCGTTTATACAGACCA
CGCGTCCTTGCGGACTGCCGTCAACACACAGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAG
CCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACAAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCA
GGCTGGGGTACCGAGACGATGCCAGTCTCGGACGTCTTGTGCGGTACTTGGCCGCTGGCTCGGAAGCCAAGGCTGAGTGGCTCACGCCCCGACAACGTGC
AAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCAGAGGATCATCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAG
TACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACA
TGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGGGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCAGGTCCC
AGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGCTGACCGTAGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGC
AAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGATGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGA
CCATTGTCTCTGATCGAGACCCGCGGTTCGCCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACGCGACTGTCGATGTCGACGGCGGACCACCC
GCAGACGGATGGCCAGACGGGGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCC
ATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCCTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTAC
GAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTTGGAAAACCTTTTCCTCCCAAGTCTCAGACGTGAGTCCAGCCACCTTGCGGAAGCAACT
GTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAACAGGGTGCAAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGA
AGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTATATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGA
AGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCAGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCTCACGACGTTTTACGT
GGATCGTCTTAAGAGGAACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCG
TCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGAATACGCAGGGGCCCCGTACGAGCCCTGGCCAAA
CTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCACGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAA
GACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCTGCTCCACGGCACCAGGCT
GACCAGCACGAGCGGCAGCCTCACCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGTAGACGAATCTCCTCTTGCTGCAG
GGCCACCACCTGACTCGGGGCCCCAACATACGGCTGCGTCGC