Description :
From Genome Similarity Track
Location :
Scaffold_153:130513- 135547
Transcript NameFunction/comments
Phyci_97204Hypothetical protein
Phyci_97205Hypothetical protein

Sequence
5034 bases(100 bases per row)
AGCGCCGCTTAGAGCGCCAGAGGCTCCGCCTCGACTTCCTCCTCGTGTTTGACGTCGCCCTTAGCTACCAGCTGTGGCGGTTCGTGGTCTTCGCACTGCG
CCACCCACTTGCTCTTCACCGGCATGATGTGGCAGTTGATGCGCATGACCTTAAGCCCCTTGGTGACCTCCAGATCGACCTGCGTCCAGTTGTTGCGCTG
GTCAGGCATTGTACAGATATGGCCCACCTTGGGCTGCCCACAGCGTCCACACTTGTACAGCTTCCGATTCGCGTCGTCGGAGCATGTCTTCTTGCTGCCT
GATGAAGAGGCAGAGGTACTCGCGCTGCGTCGCGGCGGCGACCGGTGCGGGTTGAGATCGTCCATGCTCGGCTCTTCCGGAACGGATAGGAAGCCCAGGT
TCATCTGGGACATATCCATCGACAGCCCCGACGAGCGATTCGCACCGCGTCTGCGAGCTGCAGCTCGCGGCGGCAGGTTGCTACCCAACGACGATCGCCG
GGCGTGCAGCGAGTGCGCCGCGCCGCTGGCAATCTGAGGCGGCACCTGGAACTGGAACTGCTGCATATTGGGCtgcatgtttggctgcatgtttggctgc
atgttcggctgcatgtttggctgcatgcttggttgcatgtttggctgcGGGGGTGCCGGAAACACCGTCGGGTCTTGGAAGCTCGCAAAAGGGTTCGGAT
ACCCTTGGTTCGGGTTCATGTTTtgctgctgcggcacttgctgctgctgtaactgttgaacctgttgctgctgctTGGTCTGCTGCGCCAGGATGCGGAA
TTGGTCCAAGTTGTGCAGAAGATCCACGGGGTTCGAGTGATGTCTCGAATGGTGATTCACGGGACGCTTGCGCTTCATCTTGAGCTCGTTCACTCCTTCC
TGGATGCGCTGTGTGCGGTAGGCCACAGGCGACGCGCCTCCAACAGACACTCCATTTCCATCCGTCGATGCCGCGTTCGCTACCGGCATTtgctgctgct
gctgttgctgttgctgGTCGGGGTTTAGCTCCGACCACGAAAGTTCCTTGAGAAACTCGTCCATCTCCTGGAACGACTCCCCCTGAGGTGTAGCCGTGCC
TCCGAACGGCATGGGACTGGCCTGGGCCTCCACTTGAACGGGGCCGATGGGCATCATGTTGTGCTGCTGAGGGAACCCCATGCTGTTGTGGCCCATGACG
GGCGGAGTGATGACACTGGGCGCCATGTTGGCCATGCCAAATCCCTGCAGCACGTCGGGGTTGGAGCGCACCCGCTTGTGCTTGTGCTGCGGAGCCACAC
GGTAGTTGGGGCCAACGACCGCCGCCCCGTTCGGGTTGAAGGAGAAGGTGAGCGGCGTGAGCAGGTCCTCGCCCTCGGCCTTGGGCGCCATCATGTTGGT
GGGCGATGAGCCGGGTACGTCGCTGTCCAGTAGCATTTGGTCGTCTGGCGCCACGAAGCCGCCGCCGACGGGCGCCGCGTTGCTGCCGCCGGCACTCATG
GAGCCGTCCGCCGGCGCGTCGCCGCCCTCAAGGAAGTTGTAGTCGAGCGGCAGGCCGTCGAAGAGGTCCAGCGTCTGCGCGTCTGCCATGGGGAGCGACA
GAGAGAATGCTATAGAGGTCGAGGACGGGATGAGGGCTCGGCTTCTTCTTGGCCTTCTTGGACTTGTGCTTCGGCGTGAGTGATTACTTGAGAAACTGAA
ATCCAGACACATCCGATACCCCTGTTAAATTCTTTCCGTTTCTGAATCGTATTAAGAAGGTTTTCGTACTTATTCAGGACGGACCTCAATGTGAATACGG
CGATTGAACGATCGCCTCACCAAATTTCTTGCGTAAAATGCATATCCTGTGACAACTTAGACGGGACAGGAATCCTAGCGAAATTTGCAGAGGAGCGTAT
CCGGAAGTATGCTGTCTGCAAGGAAAGACGCATAGTGACATGAAGCTTTAGATGACGGCCTAGTAGGCCTATCCGGATCGCATCGAGTTTGATGAGGCAA
CCGCCTAGCCCTGATCTACCAGCCGCTTCAGCTTGATTGGGGTGTGCAACATGGCTACATTCGATGGCACCACAGCAGCATGAACGCGTTCACAAGAGCG
CCGACAAACATCCAAACCCTTAATTCTCCGAAGGAGCCCCGCAAACGACACTTTCTTTATACTTCCTTGCTTTATACATACCTATGCGGGAGAATTAGCG
GCTGCCTTCGCCGCGCACTACAGCGCTTGCGAGTGAGGGAACGCCATGGTCGAAGCGGCCCCGAAGTTAGACGGGCCCATCTCGTACGTCACGGACTCCG
CCGGCTGGTGCTCAACCGGCTGGTAAAAGCTTGGGTCCAACACGCCAGCTCGAGCAGGATCTTGCAACAACGCCTGCAACACGCACGCGATCGGCCGAAG
GCTGTCAGCAACCAATGTCAAGCTCAGATGCGTCCTCCCAGGACAAGCCAGCCGCGCCGACGAAGCAATGCCCCCGTGATCACTTCATCCCCAGACGCTC
GGCGTCTTCTTAGAAAAGAAATTCACTCACCTGCAGACTCAGTGGGCTCAGCTGCGACGCATCCTGTCGCGGGTACGGATCCCACATACCCGCACCATTG
GCGCCGGGCTGCTGAGGCTGCTGGACTTGCTGCTGCTGGCTGTCAGCTATCCGGGGCATGCCGTCTTGATCGATCTCGCCATTCGCGGCGGGGACAGCAG
GCTGGAGCCAAGCCTCGCCGCCGTGTTGCTGCTGCTGCTGGTCGGCATGCTGGTGAGCGGGAGACGCACCTTGGCTACCGGCGCCAGTGGACGTCTGTCG
TTCGTAGTACCGCGGGTCGTAGCCATTATTGGCGACATAGTCTTGACCCTCATACTGCTGCGGTGGGGCATAGGGCTGCTGAGCATAGGCAGCAGCGGCA
TACAAGTTTGGGTCGCCCCCAGGCGAGTGACCCATGAGCATAGCGCGGTTCTGCTGGTACGGTTCCGCCTTCAAGTCTTCTGTGAGCATTGCAACGTGGC
TTATGTGCTGGCCTTGCTGCATTTGCGCCTGCTGCTGCATGAGCTTCTCGTGGAGACGCATctgctgcatctgctgctgctggtcgagctgctgcactgc
ttccgtgttgtgcgcctgcaggtgttgttgttgctgcagaagctgcaactgtcgctgGCGCATCAGAGCCGGATTGTTGTACCCCATAGCAGCTTGCTGC
GCTGCAGCAGCCTGAGCTTGCTGTTGGTTCTTCTTGTGTTGTGCATGCGAGGCGGCGGCCTTGCTAGGGTTCTGCTTCAGAGACTTCCAGCGGATCTTCA
CCGAGTCCTCCGTACGACCCTTCAGGAGCTGAGCAATCTGCGACCACTTGTTGCCCAGCCGTGCCTGCGCAGTCAGGATGACCGAGTCCTCCTCTTCCGT
GTAGGGGCCCTTGTTGATCGCCGGGTCCAGGTGGTTTTTCCATCGTTCACGGCACTGCTTGGGTGTGCGCCCTGGAATACGCTCGGCGATCTGCCCCCAG
TTGTTGCAGCCCTGTGTCACCAGATACTCGAGCACTTGATCCTCTTCGAACGACCAGTGACCCTTCACTAGACCAGGCTTCAGCACCTTGCGCCAGCGCT
GCAGGCACTGGGCGTGGTTGCGTCCAGGGACCAGCTCGGCAATAGCCTTCCAGTTCTTCTCGCCGTGGATACGCACACTCTCACGGAGGGCCGCATCCTG
ACTCTTGGTCCAGCGCTTGGTCGTCGGGGCCTCTGGGTCCTCGACAGGCTCCGAGTTACCATTGGAATTCTCTGCGTTATCTCCGTTAGCTGCCACGGGC
GTCCCTGCGTCGGAGCGAGTGCGCTGCGTAGGCTTCTGCTCGCCTTCAACAAGTGTGCGGCTGCTCTCCGGGCGGTCGCGCTTGGCGGCGGAAACATCGT
CGTCCTGGTTCGAAGCCGATGTGCTGTTGTCGCCCGGAATGAAGCCCTTCTTGTTGATTTCCAGCTCGCGCAGGTTCATCTCAGAGTCAGCAATGTGCGA
GTTGCTAAGCAGTCGCCCCACCTGGGAGATATCTTCCTTGGAGATCACCACAGACGACGAAGAGAGCGAGCGGCCGACGACAACGCCGTCGGCGTTGGGC
ATGCCAGCCAAGTGCTGGGCCGTCAACTTGTGGCCGTTGGTCTCCTTGCTGCAGATGGCACAAAAAAAAGGAAAGAAGTAAGCAAGATGTAACTCGCGGC
TACACACTCTATGCAGGGCGGTCGTACCCATCGGGGCCCACCACGGCATTGAACGAGTGAAACTTGTTGGCGCCGCCATTGAGCATCTTGACGCGGCTGG
CAGCTGCAGCACAGAAAACATCGAAAGAAAAAGAGGGGTTAGAGAGAAGTCGAAATAGAGATAGAGGAGCCGGGAGCTCACCGTTAAGCGCCTGCTTGCG
CTTGATGTGCGACTCCATGTTCTGCTCCTCCTGGGCCTGCACCTCGGCCAGCTTGGCCTGCTGCACGAGGAACTTCTTGCGCAGATTCAGGATGAACTTC
TTCTTGCCCTCGACGGTTGACTCGGCCATGGCCTTGATCACGCGGAACTGCTTCTCGTCGCGCAGTCGGTCCACGTAGCGACACAGCTCGGCGCTCTCGC
TCGGGGAGAGGCCGCTGAGCGCCATGAGGAAGAGCCGCGACGCCTCGGCGGGCAGCGACTGCAGTAGTTGGGCCAGCAGATCGCCGAAGTTGTCGGCGGA
CGCCGAGTCCGTGGGCGGCGCGGGTTCCGGCTGGTTGTCGGTCGCCGTGTCCGCCATGCTGAGACTGGGAGGTGAGGGAGGCGCGCGGGCGGGTAGTGGG
AGTGGAGCACTGCTGCTGCAGGACGGCGGCTGAGCGAGTGCGCGCGCGGGCGAATATTGCCTTTTGCCGGCCAGCGGTCGTTCTCCCCCTTTTCGCTACC
AGCTCCCCTTGCCCCTCTGTAGAAACCCCCCGATTTTACGTGCCCCCGATATATCCGATGTCATCGCTTTTAAAACAAACGATAGATTTGTATTGAAGAT
GATTTCATGAACTGATTCCCCGTCACTTTCGCTT