Description :
From Genome Similarity Track
Location :
Scaffold_242:13050- 15377
Transcript NameFunction/comments
Albla_Nc14106250chaperone clpB putative

Sequence
2327 bases(100 bases per row)
GGCCCTGGAACGGGTCAAAGCTCGCATTGGGTGAACCCGGAAAATGTGCCGCGTGGAGAAAGTTTGGTGAAATTTGGACGCGATCTAACCAAAATGGCTC
ACGCAGGCCAATTAGATCCGGTCATTGGTCGAGAAGAACAAATCCGGCGCTCCATACAAATTCTATCGCGTCGTACGAAGAATAATCCGGTGCTGATCGG
AGAACCTGGAGTAGGTAAAACGGCAATTGCGGAAGGATTAGCTCAGCGAATCGCATCAGGGGAGGTCCCTGAAAGCCTGAAAGAGAAACGAGTTGTTGCA
TTGGATCTCGCCGCATTAGTAGCCGGAGCAAAGTTTCGAGGAGAATTTGAAGAGCGATTAAAAGCCGTACTTAAAGACGTCGAAGAGTATCATGGTCAAG
TGATCTTGTTTATTGATGAGCTACATACCCTGGTTGGTGCCGGTGGGGGAGGTGAAGGATCTGTGGATGCTGCAAATATGCTGAAACCTGCCTTAGCTCG
AGGATCGTTACATTGTATGGGGGCAACGACGCTGGACGAATATCGTAAGAGTCTACGAGCGGTATTGAGCATGGAAACTTTGGCTGATGATTTTTTTGTA
TAGGAAAATACATTGAAAAGGATGCGGCGTTGGCTCGTAGATTTCAGTCCGTTTTGGTGCCGGAGCCGAGTGTAGAGGACACTATCACGATATTACGGGG
ATTAAAGGAGAAGTATGAGGTTCATCATGGAGTTCGCATATCGGATGGAGCGCTCGTCTCGGCTGCAGTTTTGGCCAATCGGTACCTCTCTGAACGCAAG
ATGCCCGACAAGGCTATCGATTTAATGGATGAAGCAGCCTCGAGGCTGCGCTTACAGCAGGAAAGTAAGCCTGAGCCGATCGAACGAATCGACCGTGAAA
TTATTCTGAGACGAATTGAGATTGAAGCCCTCCGCAAAGAAAAAGACCATGCGTCTAAAAAGCGAATGCAACAACTGGAAAAAGAAGTATCACATGTAAA
CGAGGAGTTACAATACTTGATGAAGCAGTGGCAATCGGAGAAGAAGCGGTTAGAAGAGTTACAGGAAGGAAAACGAAAGTTGGAGGAAGCACGTCGTGAG
CTTGTAAATGCTCAAAATCGAGGAGATTACGCCCGAGCTGGAGAGCTTCTACATGCAGTTATCCCTCGTCTTGAAAAGCAAGTCGAAGAAGAGGATATAG
CCGCGAACGAGCACAATAGCAATACGCCGGCCACTTTGGTTCTCGCTGACGATAAAGATGAGTCTGATGTGAAAGCACTGAAGAAGAAGCTTGTGCTTGG
TGATGCGGTTACCCCGGACCACGTGGCAGAAGTGGTAGCTCAAGCAACCGGAATTCCAGCCTCCACTTTAATATCTGGTGAGAAACAGCGTTTACTCAAA
ATGGAAGAACATCTCGGTCGTCATGTTATTGGGCAAAAGGAAGCAATCGTTGCAGTAAGTAACTGCATTCGTCTGGCTCGGGCTGGCTTACACGCACACA
ATCGTCCACTTGGAGCATTTATGTTTTTGGGCCCAACTGGAGTCGGGAAAACAGAGCTCACAAAGGCTTTATCCGAGTTTCTTTTCCAAAATCCGCTTGC
TTTGACTCGAATCGATATGTCAGAATACATGGAAAAGTTTAGCGTCAGTCGTCTTGTCGGTGCACCTCCAGGTTATGTCGGCTACGAAGAAGGTGGAACA
TTGACTGAAGCCGTACGTCGACGTCCGTATCAAGTCGTTCTATTCGACGAGTTTGAAAAAGCCCATCGCGATGTTTCCAACATTCTTCTCCAGGTCTTGG
ATGAAGGTCGTCTTACGGATTCGCAAGGTCGACTGGTGGATTTTAGAAACACTGTCATCATCCTGACAAGCAACTTGGGTTCTGATAATCTTGCATCCCT
ACCGGAAGGTCTTCCCAGCTCAGTCGCTGAATCTGACGTGCTCTCTATCGTTCGAAGTCATTATTCTCCTGAATATCTCAATCGAATCGACGAACTGGTA
CTATTCAATCGACTCGCACGTCAAGATTTGCGTGCAATTGTCGATCTACAGCTGGATCAAGTGCAAAAGATGCTTGCGGAGAAGGAAATGAGCATGCATG
TAGAAGAAGATGCGAGACAACGACTTGCTGAAGACGGGTATAGCCCCCTGTATGGTGCTAGACCTCTGAAACGCCTCATTCAGCATGAACTGCTGAATCC
GATGGCGCTTAAACTATTAGCCGGGACAGTTCACGAAGGAAGCACCATTCATGTGAAGCTTAACCCGAATTACGAGCAAGAGGTCACGGCTGATCCCACG
CACGCTCGACCATTTCTAGTAGAATAA