Description :
From Genome Similarity Track
Location :
contig_19:130476- 133494
Sequence
3018 bases(100 bases per row)
GCAGGCATCGCGCTCGGAGACCAACACCAATGAATCAACATGCAAATTCGGGTGACTCAGCTTCGCGCGCACCACCTTGCAACAAAAAGATGACAAACCG
CAGAACTGTGGACCTGGCCATCAAAAGCTTTATCAAGAAGCGAAAGTGCACCCCAGGTTTGTCAATAAGACAAAGCCTCCAATGATACCAGGATTCAATA
GCTTCTTAGTTAAACATACACAGAGGACCCAGTTAGACTTTGTGGCTCGTCGTCGAAGCCAGAAAAATAGAAATCACCGCGCTGGTCTGCAGTGCAGCAT
CGATGTTTTGGTGGCACCGAAGCAGCAAGCCAACGACGGCAACTTTGGTCCGAAATTTTAGCGGCCTCGATCGGACCGGGCTCCTTCCTTCCGGGGGTAG
CTGGCACGTGCGGTGTAGCGCATCTTCAGAGTGTTACGCTGGGGATGTTCGCGCTCGGTTCCTTCTCGATTCCTTTTTGACGGCTCACTCGTCACGCGTT
CGACGCTGAGCGATGATTCCTTTGGGCCCGTGCAGACCCCTGATGCCGCCGCCCGCTGTCCACAACCAATAGCGAAGCCCCACGGTAACGCAGCCAAAGC
CGGCAGCCGAGGACATTCCTGCAATCGTCGCTGGCATCGTTTACGGCAATGCCAATTTGGCATGGAGAGAAGCGACCGCGCACTGTCAACAACCACAATG
ACGACCCAAGTGTGGAGGGAGCCAGGGAGAGCTGTTTTGCCAAGGTATAACCGTACAGGTATGTAGTATAGCGACTCGGGGTCTTGCTTGAGCGGTTGTT
GTTGACATCTAACAATGGTGCCTCAACCCAGCAAACGCCCCCACTTTGTACTGTAGGTCAAAGACGATTGCAACCTGTACTGGACGTTCGTTTGCGTAAC
ATCACCAGCGATGGTATGTTTGGCACGCTGATTCTCTCAGAGGCAAGCACATTCTCTCGTTTCTCATCAGAGGCAACAGTTTCGCCTAGATCACTCGTTG
GCGTACTTACCTGCTACTGCTTTATTCTCACGTAGTCGTTGTCACAGGCCCAAGTCGTTTCCAGCACCCTCAGTGTCTGATGAACTAGATACCCACGGGT
CGTCCACACTGTACTGACCACAAAAGTTTCATCCCCAGACCGTGAACGAAAACAACTGTACCATTGGCGAGGTACGGTACGGTTGCTAGCCTCAACAAAC
AACAGCAGCGTGTCTCGAAGCAAGTGCTTCCCGGCACGGATACCCGTCGCATGCACGGTCGTCTGCACGGTTCACAGCCAGCTCACTGTGATTGCCTGGA
CTCGAGTTTCGAGCCAGCTGCTCACCTCGTGGTTACCTGGAGCATGGAGGATTTCTCTCTCCTCCACGCGAAGAAAGAGCCCTGGCGATCACCCCTGATC
TTAGCAATGGGCTACACGAAGTGGTGGTTTCTGTGGCTTCTTCTGTGGCTTCTGCTCAGGTTCTTCCAGTCTGCTCCGTTCTAACGCATTCATGGCCATG
GACAGATAACGGCGAATGATCTCGCCTTGAACAGATAACGACGGATGATATGTATCCTTGAGCAAATTCGGCTTTCCGATCAGTAGTGATTTGTTATACC
TTTTCCATTGTGTGGAAATAGTAGTATGTGGCTGCGCTCAGCACTTACTTATCCGTTAGCTTGATTTGCGGACGCTAAGTCCTCCGAGCCGGGAGCCCGT
GCTGCCGAATCCCAATGCAGGCAAGCCCTCGCTGCTCTGTTTCGGATGTTCTATTGATTCTATTGACAAGGCCAGCCAGCGAGACCTTTGGCACTCAAAG
AGCAATGGAAAGGCCTTGTGTCGACTTTGCCGAAATCGACGGAGGGTCTTGTTTGTGAGGTGTCGGAACTTGCTTGTGGATTACGGTTCTGGAGGTTGTA
GTTGGTGTAGTTGATGCGCGGTGTTGAGGGCAAAATACAGAATGGTTATATTTTTTGTTTTGTTTTCGTGCCCTGTTGTTTCTTGCTTTCCTAGGGCTCC
GCTCTAGGAACGACACCTTTCAATACATACACCAAGTCTTGGTTGTCTTCTTCAACCTCTTGATTATGGTCGTGGCGATGCTCGCCGTTGGCTTGAACGC
TGGGTTCGCGTGGGTTGCAGATTTGCAACATGAAGCGCTTTGCTGGCAACCTGATCGTCTGTTGCACGAGCATGGGCTGCGAAAGCTTTCCTGTTGACGC
CACCACCATCAACGAGTGTGTCATGGGTTGTTGCCGGTGCGACTCGACTTGATTGTCCGCGAGTCCGAGCGCTAGCGTGGCTTGCGTTGCGCGCAGCCAA
AGGCTGACAATCTCCCCTAGAAGAATTGCTCTTACTGCGTTGCTGCTCCCGCAGCCCCTTCAGTAATTGATGCCAATGAACGACATGTTTGATGTCCTTC
TCTAATTCCCATGTACACTCTGACATCGGCTCACCAAGCCACTTGACGAGATACTCTGGCTTTCGGTTAAACTGCCTTTTGGCAATGAGCCGCTCCACAA
TACGCATACCGTCGTCGACAAGTTCATCGGGCAGTTCTACTGGGGTGTCCTTGAATTTTGGGCGCGAGCGGAACCGTTTGAACTGCTCTGGGTACGGCGA
AAGGAGGTCGACATTGAAGGAAGGATGAATGCGTCGAAATCGCTTTGGTAATTTGAGCCTAGCCACGTTTTCATTCACCATGTACTCGATGGCAAAAGGT
CCCACCAATCGTGCTGCCAACTTTGCTTTAGTTAGCTCCGTGTTCTGAGAAACATGCTTGAACGATAGATGCTCGGTTTTCAGCAGTACCTGATCACCAG
CTTTGAAGTCTGGTTCCGACCGACGCTTGTCGTAATACTGCTTCTGTTTTTGTTTGGCGTCAAGAAGAGCTTGCTGTGCGCGTTCAACAATCACACGTCG
GCGCTCAGCAAACTGCCGAGCAAATTCTGCCTTGGTACGTACTTGGCGAACAGTATCATCAGAATTCACAGCTCCGGGGTGCCGTGCAACACGACCACAG
TCAATCTCGAATGGTGTC