Description :
From Genome Similarity Track
Location :
Scaffold_110:13047- 15553
Transcript NameFunction/comments
Sapdi_VS20SDRG_16018hypothetical protein
Sapdi_VS20SDRG_16019hypothetical protein

Sequence
2506 bases(100 bases per row)
TTTGTGACTCTTTGTGTCGTGCTGGTGTACTACTCGACGCACGTTGCTGCGGGCATGAAGCCCGAAGAACCGACCCAGACGACGTCCGCGGAAATGCACG
CAATAGCCAATACCACCGACATCAAGGTCGGACGGCGCGCGCTCTCGTTAACTTAAGGCATCACTAGTAATATATCCACGCACTATATAGGGTTTGAATC
ACTTTCGATTTTGTCCATTTAAGAAGCGGTTTGGATCGACAGGCGCCGACGGGTCGCCACGGTTTCCAAGCTCATACAGTAGTGTTTTCGCATGCGATGA
TGCAAAGTCAGTCGATGGCCCGAAAACGTGCAAACCCGAGCGTCAGGCAACTTTCAATAATAAATACTTTACTTTGCGCCGAATCTTCGATCGATGTGGC
GCAGGCGGCGGAAGACAATGGACGGTCGTTACGCCACCACCCAACCTGGGTTGCTTGTGCGACTTGAAGCCGACGTGTGGCTTCCGCTTCGGTCTTTGCG
GCCAAGACGGGGGGCTTTCCAGGACCGCATCGAGCCGAGAACGAGGGTAGCGAGGGCGGCTTCGTGCTTGCTGTGGCCCAAGGCCGGGTTGTCGTAGATG
CCTGGCGTGATGTTGCCCCGCGTGTCAGACTCTGGGCACACGCCCAGGTGCAAGAGAAATGCTTTGAGGGCGTCCGGCGTCTCAAATTTGACGCAGAGCC
TGTCGTCTTCCGGAAGCGCGATCAGTGCCTTCAGATTGGCGTGCCATTGGACGCGAACAATAGTGTCGAGTGGGTAGTGGGCGTTGGTGTTGAGGACGAC
AAGGACGCCGACATCGGGGTGGACCTCGAGAGCGATAAAAGACCGGCGCCATCCAACCTTGTCGAGGACGCTCGAGTACTTGCGCGTGTAGTACACAACC
ATGGTAATGCGAAAATGACTCGTTTTGTAGCATACGGGAGGGTACGCCACTGAGGTAGTGCGATAGTATCTTTTCACCAAATATTGCAATGCGACCGATA
CAGTATTTCTGGATATCGACTTCCTTGTGGACAAACTGTGGAAATGGCCCGCTATTACCAGTCCCGGTCGATGGCCATCCACGAGGCGCAAACCACGCCG
TCCGAGTGGTGGAGTTGCGAAACAAGCAGAGCCCCAGCATCTTGGTGAATCCGCTAATTACCTCAGCCGCGCTGGAAGGCGGTGGTCAGTCGCTGGCCAG
CGCGAGGGCCAGCACGATTACACCCATTTTTTCTGCGGGGCTGCTCTGCGGGCAAACAAGCGTCAGCGGTGTATGTCGCCCATCACCTATCCATTTCATC
GGGCAATGCACAAAGAAGATACTACTGCCTCGCAAATGCTTAGCTGGTCAAAAATTTGCTGCCCTCTGACCTTGAAGGTACAAGCGTAAGCGCTGCTTGT
GATTTACCGTCATCTTGGGCGTGAAGTCCCACGAATGTGTTGCCTTGGCGTTGTCATCGTCAACCTTGGGCTCTAAAGCAACAATTGTGGCCATTGGTTT
CTTCTCGAACGGCGAAAGCCCATCTTCTTCCTTGGCTTGTGGCACGTTGCACAGCTCGTCCTTGAGTGTGGCCATCTATTACACGCGGCGTGTGAGCTTG
CAGCCGACGATGTACGGCTGGTGACCGTGTTGTGGAGTTGTGCGCATGCCGTCTGCGATGGGATGGATGTGGGAGACAAGCAGTTTACGAAAGTCTACGC
TACCTCTAACGCAGAGTGTTGCGCATGGATCGGTGCTAGCTGGTAGAGAAAATGAAGCTTGTGAGCTGGGTCATTCGAAGGTACGTACTTGCTGTGTGAG
CTGGCCGACGTAGGTTGCATGTGCCTCGGCAATCAGAGACCGCCGCGTCGCATCCAAGGTGCCTACCACAATCCGAAACGATGGGCGTTCTGATATCGCA
GCTGGCGAGGAATACGCTGCAGGTACTGAGCGTGCTGCTTCATTTTAGTCAGCTGCTTGGCCACGACATCGCGAGCATCTCGCTCTCGTTGGCACTGACG
CGCGGCTTCGTCTCGCTACTCGCGTTGGAAGTTGGTCGCTCTTTTGCTCATTTGCGGCTCACGGACCTCGGACTTGGTGTGCTCAAGCTCTTGCTGGAGG
AGTTGTGTCTACACTGTACAGTCAGCAAGAGTGAAAAAGCATTTGAATCGTTGTTGCCACCTTGGCCCGCTCGGCAGCCACCTCCTGTACCAAGCATGAA
CATTTTTTGTTGACAAGAGAGAGTTGAGTGCTTGTCGCAGCGAGCGCTGTCGTTGGTCGCTCCAAAAGGCTATCGAGAAACTGCGATGAGTTCATCATTC
TTCAATATGGTACTGCATCAAAGAAGCTTCGCACGTACGCAGCGACAAGATGCTCCAGCTGCGCAGCCTCTTGGGTCAAGTCGAATGACGGGCGATCCTC
GCAAAGAAGTAGCTTCAAGTCGCATGTCGTCAGCGGCGAAAGCAGCCGGAGAAGCCACTGCACAAAGAGGCTATTCGCCTCGTGCTCAGCGACATCCGCT
TGCGCA