Description :
From Genome Similarity Track
Location :
Scaffold_542:13045- 14935
Transcript NameFunction/comments
Phyke_g10148hypothetical protein

Sequence
1890 bases(100 bases per row)
TGGGTGACTCAGCATCCTGATTATGCTAGTCACGTCCTTCCACTGacaggagcagcacaaagtCAAAGACTATGCAAACTAATACTGACCGAACTAagac
tggagctggatgtATGTTGCCTCCATGAAGGGGGTCATGGCATGGCGGACAAGACGACCGGAGCGCCAGTGCTTTTGAGTGCAAGAGAGAAGTTAGTGCC
ACAAGTGCTTCGATCGACAGGGTTCAAAAATATAGCACTGTATCCTCTCCATCGAGATGAAGCGAGACGACAACTCACGAGAAGGTGGGGCGCGCAATCA
TCAGTTGCGCTGCCTCCGTTGACGGACATTTACGCGTACTTTGGTCCCCGTATTGCCATGTACTTTGCCTGGCTTGCGTTCTACACGAGAATGCTTGTGC
TGCCCAGTGCATACGGCGTTGTGGTGCATGTATTGGAGATGCTCAACCTGGCTCCAAGTTACACGGTGCACTGTGTGTTTATAGCTATCGGGACGTCACT
GATTGCAGACATGTGGCGGCGCCGCCAGCAAGAGATTGAGTTTGCTTGGGGTTACGATGGGGTGCTATCGTCGTTGCACGCGACAACACGGATTGAATTT
CGAGGCGAGTGGATGCAAGACCCTGTCTCGGGGGTGCCGTGTTTTGACTTCCCACACCACAAGCGGCTACTGCGACAGCTCTTGGCCATCCCTCTGCTAG
TGTTCatgtgctgcttggttgGTGGGTACGTCGTTGGACTGCACGTGCTTTCGGAACGTCTTAGAGCACGCTTTAGCGATAGCTGCGACCACGCGCGGGA
TGACATCCAAGAAATTGAGTGGGGAACTGGGTATTGGTCGTACGTTCCGGTCAATTGGATTCCTAGCAATGACACGACGACATGTGCGCTGGTGTCGCAC
GGACCAAGTGTGCTGAACGCATTGATCATCCACGTGATGGATGTTCTGTACCAGTTGCTGGCTCGGAAACTTACCGAATTCGAGAACTACCGCACACTTG
ATGAGCATGAAGCACATCTCGTGGCGAAACGGATGCCGTTTCACCTTGTGAACAGCAACGCCTCTCTTTGGTTTCTCGCTTTCTACGTGCAACGTCTAGA
CCGTGTCCGAGAACGACTGTGGATTTTGCTTGTTGCTACGCAGCTATTAGACAATTTCAAAGAGGTGGGACTGCCGTTAGCCATTTCTGTGGGTGGTCAA
GTGCTTACAGCTGAGAGCAAGcgacgtcgtcgacagaGCCTTCAGATTGACAATGGAGCCAACAACCAGCCCCAGCGAAAAAACTCGATGCCAACGTTAA
GACCCACCAGGGAATGGGTGGATGTAGCCAAAATTGCCACTGAGCAGCGGTTGGCTCGGGTGTTGATGCAAAAGCGGCAGGCTACATACCGCGACACTTT
TGCAGACTACAAGGAGCTTATGGTTCAGTTTGGTTATGTGACCCTCTACAGCCCAATTTTCCCGCTGGCTGCCGCTTTTGCATGGCTGAACAACATGATT
GAGAGTCGCTCAGACCTACTCAAGCTTGTGAACCGCCATGGCTATCAACGGCCAATTGCACAGCACGCACGGGGTATTGGTGTATGGGAGAAGGTACTAG
TGAGCTTTTCCGGGGTGGCTGTGGTCGTCAACTGCGCGCTCGTGTGGACCTACgagatcgacgagctgctacCTTCGTGGACAGAACTCCAGCGTTTTGC
CATCGTCGTGGTATGTGCCTGCCACTAACGACTCTAGTCTTGCTATTGAAATGCTAATCGGCTTACTGGGTTTTCTGTTATGCTTTACAGGGCTGCGAGC
ACGTGATCTTTGCCGTCAAGGCCTGGTTGAACTGGGCCGTGCCTGAAGTGCCTGTGACCTCATCACTGAGTAAGAAGCCGGCGTTGTCGC