Description :
From Genome Similarity Track
Location :
scaffold_584:13044- 15148
Transcript NameFunction/comments
Pl_103646myosin-like protein

Sequence
2104 bases(100 bases per row)
ATACATACACAGGACGCATCTGTATCGCCGTGAACCCGTACCAATGGCTGGATTTATATTCCAAACAAACAATGGAGAAATTTAGCGATGGAAAACGGGA
CAACAAGCCTCCTCACGTTTACGCCGTGTCCATGGAAGCGTTTTTCAACATGAGACAGAAACAGGAAAACCAAAGTATTTTGGTGTCGGGAGAATCAGGT
GCTGGCAAAACGGAGACCACCAAGATCGTCATGAGTCACTTGGCGGCTCTTGCCACGAACTCCAACTCCAAAGTTATCCAACAAATCATCCAGGCCAATC
CATTGTTAGAATCTTTTGGAAATGCCAAGACCGTACGCAACGACAATTCCAGTCGTTTTGGTAAATTCACGGAACTTCAGTTTACCATTGAGGGGCAACT
GATTGGTGCCAGATCCCGCACTTATTTGCTGGAAAAGAGTCGCGTGACGACACAAGCTGATGGAGAACGCAATTTCCACATTTTCTATCAGTTGCTGGCG
CAACGCAAACAATTTCCAGAACTGGCACTCGACATGGTAAACTCATTCAAGTACGTTTCGGTGCGAGCAGAAGCCCCCGGTGGGGACGAAGAAGGGTACT
TGAGTCGTACAAGAGAAGCTCTGGAACTCGTTGGGATTGAACAACCTTTGCAACTGGAAATTATCCAAATTTTGGGTGCCGTGTTGCATTTAGGTGAGAC
AGAATTCACAACTCGAAATGGCGATGTGGACGCTTCTCAGTTGGTGGATGTGAAACATTTCACTGTGGCTTGTCGTCTATTGGGTGTGGAGGTGGACGCA
CTCGAACGTGCCGTGTGCAATCGCAACGTTTTTGTCGGTCGGGAAGTGATTCTCAAGCCGATGACGCAGGACCAGGCGGCAGATTGTCGTGATGCTTTGG
CAAAAAGTCTCTACTCGAAATTGTTTTTGTGGCTCGTGGAACAGATCAACGAGACGATCGGCGTTAAGACCAAAAGTGCTGGCTCGTTTATTGGAATTCT
CGATATCTTTGGGTTTGAGCACTTTGAGACCAATTCGTTCGAGCAATTCTGTATTAATTACGCCAATGAGAAATTGCAGCAGAAGTTCGTGCAGGACGTG
CTCAAGACGGTGCAGATTGAGTACGAAGAAGAGAATATTTCGTGGTCTCACATTACATTCTCAGACAACCAGGACGTGCTGAATCTCATCGAAGGCCGCT
TGGGTGTCATCAGCTTCTTGAATGAAGAATCGCTGCTTGCCACGGGCACGGACGCATCGTTTGCGAGCAAATTGGGTGCGGTGATGGAGAATAACCCGTT
GCTGGAGACCCCTCGGCTAAACAAGTGCGCGTTCTCCATCTACCATTACGCTGGGAAGGTCACCTACGACGCAACGGGCTTCCTCGACAAGCACCGCGAC
GCCATCTTGCCGGATATTAAGCAGTGCATGAGCAAGTCCAAGCTCAAGATTTTGTCCAAAATGTTCACGGATGATGTAAATGCCAGTAGTGCTAGTAGCA
CTGTGTCTAGTGCTCGTGGCAGTGGCAGGACACGCAGCAGCAGCTCAAAGAAGGGAGGCCACGCCCAGACACGCCGAACTACAGTCGGTACTCAGTTCAA
AGAGAGTCTATCGCAACTTATGGAGAAGATCAGTCTCACTGAGGTGCACTACGTGCGTTGTTTGAAACCAAACCCGCTCAAGAGTGCTAACTGCTTCTCA
CACGGCGATATTGTGAGCCAGTTGCGGTGCGCCGGTGTCATTGAGGCCATCCGTGTGTCTCGCAGCGCCTACCCCAGTCGCATGCCGCACTTGGAGTGCA
TCAAGAAGTTCCGTGTGTTGCTTACAGGAGCAGTTCCAACACAGAATAAGTTTATCAGTGACTCGGACACGGAGCATATCAAGAATCAGTGTGAAGAGTT
GATGGAGAAGCTGTTGCCCGGGCGTAATATTCAGGACTACCAGGTGGGTCTGACCCGTGTGTACTTCCGCGAAGGTGTTCTGGAGGAGTTGGAGACCAAG
CGCGGCTGGGCTCTGCGCAAGTATGCTATCGTGTTGCAGAAGAATGTGCGCTGCTGGCTTATGCGCCGGCGTTTCTTGCGAAAGAAGAAGCAAATTGTTG
TCAT