Description :
From Genome Similarity Track
Location :
Scaffold_77:1304- 28679
Transcript NameFunction/comments
Phyag_g1654tetratricopeptide repeat protein, putative
Phyag_g1655hypothetical protein PHYSODRAFT_263017
Phyag_g1656hypothetical protein PHYSODRAFT_354827
Phyag_g1657conserved hypothetical protein
Phyag_g1658hypothetical protein PHYSODRAFT_315971
Phyag_g1659hypothetical protein PHYSODRAFT_509250
Phyag_g1660hypothetical protein
Phyag_g1661hypothetical protein
Phyag_g1662P-type ATPase (P-ATPase) Superfamily

Sequence
27375 bases(100 bases per row)
AAAGCCAATCACTTTTCAACCGAAGCAATGGCGGACGCAGACGATCTGATGCAGGAGCTGTGCGGCGTGAGCCTCTCGGCCATCGACCACACGCAGGATG
CAGACCAAGAGCTACTagagcagcgtcttcttgcaATCGAGCGCGCAGTGCTGGAGAGCGACACTAAGAGCGTTGTCGATGCACTCAAGGgtgacgacga
gatggctacagtccTGACCATGGCGAAACTCATCTGCCAGGGCGAGTACGCAGATGTACTTCGACTGCCACATGCGCAGAGGCTATTGCAGAGTGTGGTC
CAATTGCGGAGCGAAGAGCAAAACGACGAGGACCAGGACGCGCACATTTGCGGCAGCATCGCGTCTGCGCTGCAGAGCTACTTGCTGGACCAATGCGACA
GTGCCGAGAGCCGCCTCGTGGCCGCCTACGAGATCCTGTTTGTCGGAGTCGCTTTCTTTGACATGTACGTGCAAGCCAACTACACAGGACCggcgttcga
gaaggagacaCTTCGAGATGTGCTCGATTTGGCCACTCGACTCGTGACTTGCTCGACCGAAAGCAATGACGCAAAGTTGCACAGTGACGCGCTAGTTGCG
CTGCAGGTGGACGGTGAGAGTCCGTTCTCCATCTGCGAGTACCCACAGTTCTTGCTCATCGGCCGCTGCttgctggactttgtgggCAACCACTCGTACA
ACGACTGGTCGGTGGCTGCTAATGAAGCTGTCAGCGGACAAAATGACAATGAGGTGCCGGACGATGTCCTTCAAGGTCCTGCTAAACGGCAAATtactgg
aggtgctgcgATTCGCGCGCTCggcgagatgctggagcagattaAGTCGGCTGCGTGGTGGAatgcgcgtgctgctgtcgcacATGAACGACTACTGCTC
GCGAAGCAGCCGTCAAACACACTGTGGTTTGAGGCTCGCCGTGGATACATTCagacgctgaagacgacTGATCTGTTCGCCTTTGAGAAAGATACACAGT
ACCTGCTTGCTCGTGCGTACGTGGAGTGGGGACTTGCCCAGCATCActtcgacaagaacaagcaTGGTAAATCTACTTTCGCGCGTGCGAAGGAGATCTC
TGGTGTGAGTGTGCAGCTAAGCGGGTCCATGGGTAAACGTACAAAGTTCCAGCAGAAGAGTGTGGCTcagatggtgctgctcgccgcATCGAAGAAAGAG
CCTGAGCGTGAGGGCAAAGAGGCCTCTGTCTACGCCACGGCTGTGGCTGAGTCGACTCACGTGGACTTTGGTGGCAagcaggtgacgacggaAGGCGAAA
ACAGCTCAGaatctcctgctcctcccGCCGACGGCCTTACGGCTGAGGAAGAGCACATTCAAAAGCTTGTACAGGAAGGCGAGGCTTCCTACCGCAATGT
GAACTTAGATCAAGTGGATCAGGACAATTATCTCTTAGAAAGCATTGCATTCGAGGACCGCAAGCTGACGGAGCAAGGCAACTTGCAGATCGCCGACCAG
ATTGTGCTACTGGGACTGTGTTTGGACGTGAAGAATAGCAACGCTAATGACGGTCTGACTCGCGAAGAGATGATGCCGTACGTCACTCGTGTGCTTGAAA
ACCCCAACAACTGGATGGTGTactcgacggcgctgctggagcgcgcgTGGCTCGAGTGTGAGAGCTCGAAGCGCCGTGAGCGAGctgtgctgcagatgca
agcTCTAGTGGACCAACACACGACGCGTCTCACGATCACGCAGAATACGCTGCAGTCCATTGCAGACTCGGCGCCAGCTCGTGAACGTATGCAGTTTGTG
TATTCGTTGGCGTTCCCGCCGCGGTATGCTCTCAAACGCGACCTGGCCGAGCGCTACTTCAAGCTTGGCGTTCTGGGCAGTGCTCTTGAAATCTGCGAAG
AGCTGGAAATGTGGGATGACGTCGTCAAGTGCTACCAGCTTCTAGACAAGCCGATGCGCGCGGAGAAGCTTGTGCGCGAGCGCTTGGAGATTGCCCCCAC
GCCGTTCATGTGGGTCACGCTCGGAGACCTCACTCAGGACCCGTCGCACTACGAGACGTCCTGGACACTCTCGAAGCAAAGGTTTGCTCGCGCCAAACGT
TCGCTCGGACGCCACtacttcgagaaggaggactATGAGGCGGCAATTCCTCATTACGAGGACGCCGTTCATGTGGGTCCCATGCACACAGGCGCTTGGT
TCACTCTCGGTGCTATTGCGATGCGTGTCCATCGTTGGGCACTCGCCATGCGTGCTTTCACGCGCgtggtgcagcttgagccGGACAACGGTGAGGCGTG
GGGTAACCTGGGCTCTATCCATTTGCACAACCAGCGCTACGCAGAAGCttttgcagtgctggaagAGGGGCTCAAGCAAAAGCGCTACATGTGGCAGATG
TGGGAGAACTACGCGCTGTGCGCTATGGAGACCAGGCGATACGGTGAGGCCATGTACGCCatgcaccagctcctggacATGCGCGCCAAGCACAAGCGCC
CGGTGGATAGTGAAATGCTGGCGTGGCTTGTGGAAGCAATTGTGTATCCTgagtcgctgaagaagatggagcaggatTCTGCAATTGAGACCAGTGCTac
ggatgacgacgaggatgaggCCGACGTCGACCGaattgaagacgacgatgatgacgacttGACGGAGCTCGACGAAGTGGCGGCGGCTACTGACGCGACG
CCACCTCGGTCCGACTCGCACTACAAGAAGCAGTTGGCGATGCTCTTTGGCCGTGTGACGTCCATCGTGACCAACGACGCCAAGGTGTGGCAGGTATACg
cgcacttcaacgacggcGTGGAGGGTCGAGCCGACAAGGCGCGCGACTGTCGTTTGAAGCAATGTCGTGCACTGCAAACTGGCGGGTGggagcgcgagca
gcagaaggtggaggatCTGTGCGTAGCGGCCAATGCGCTGGCGCAGGACTACCTTGCCGAGGGcaccaagaaggcgctgTACTCGTGCCGCCTATACATC
CGTGGTGTACTCAAGAAGGCGCAAGTGGACTTCGCTGAACTGGAGGCGGTGAAGacgctcgctgctgcgctggatgAGGTCAACGCTAGAGAAGCGCAGC
TCTAGGTAGACGAATAGGTTAGGTGTCCTCAAACAGGAAGACAACCCGTGCATCAAAATGTTGCAagttgtagccattttgcaaTTGACAGATACCTTGC
TATTTCATCCAATCAAAAATCGCAATAGATTTAACTCGAGATTTGTATTCAAACCTTCAAATGCCAAAGATGAGCCGGTTTGAATACAAACTTCGAGTCT
CGCGTTGCGCGGGCGATTTTGGCGCCGGTGAGGCAGTCGCCAATCAACCGTCGGGGTCTCAGCTGTACATTGCGTGTGGATAATGCCTCCGAAGCAGGGT
GAGCGGCGAGGCGTAtcggccgccaagaagcgcaaactcGAGGCTGTTGGGCCCAATGACGAACCCAAGAAGGTCAAGCGCGGACCTGGTCGaccgccca
agaagaagaagaaagctgTGATGGCCGTCAAGGAGGCTGCACCTGAACCTGAAGCCGAACCGGAACCCGTTTTGGACCCAGAAACAatgagcttcttgca
gcttctAGAGGACGACACACGTCGACTTCCGCCCCCTCCAGCGCCGCTCCCTAAACGCCGAGGAACCGCCAAGTCCCCACCCGAGAAACGCGTCGTGGAA
TTCCAATTGCCATTTAAAGAGGCGGAGATCAAAAGCCTCGAGGAACGTCAATGGGTGCGTCGCCCACCGCCTTTTGGCAAGATCAGTCGCTGTGTTTACG
TGTCCACCAAGATGCCCATTGCCGACTTCCCCGTGCACAAATGCACGTGCTGTGAAGAGACCCACAAGTCTATGACCAAGCGCACGACCATGATGGCAAA
TGTCAAAGCacagaaggagctggcggtcAAGGGGCTCTGTCCGTCGGCGCGTCATGCGgacacggagaagcagcatGAGCTGGAGGGGATGACGTACTGT
GGAGAAGGGTGCTACAACCGCATGCTGTTCATCAGTTGCTCGGATGAAACGTGTTCTGCTCCTGATTCGAGTATGTGCAGCAACCGAGCGATTAAGAGGA
GGGAACTGAAGGAGGTGAGAGTGGAGTACATCCCCGGACCGGGATTTGGACTCATTGCCAATGAGAAGATTAACTCCGGAGAGTTCATTATTGAATACGT
CGGTGAAGTCATTGATGACATGGAATGCGAACGCAGGATGATCAAGTACAGAGATAATGGCGAGGTGAGTGATACCGgtcgtcgtgctggttggtgctga
agttgcagtgTACTGATCATGTTTTTGCTGCCAGGTCAACTTCTAcatgatggagctggagaaaaaCATTGTGATCGATGCGAAATATCGCAGTAACGAC
TCGCGCTTCATTAACCACAGCTGCGACCCCAACAGCGTCACGCAAAAATGGTACGTTAACCACTACGTTGTGGTTGCACTGTTGAGGTGGGCGCAGTCAC
TTATATTTTTTTCTGTATCTGACAACAGGAATGTCGACGGCATTCAGCGAATTGGCATTTTTGCGCGCCGCACTATTGCTCCTGACGAGGAAATCACGAT
TGACTACAACTTCTCTCATTTTGGCGAGGCTGCCGAATGCAAATGCGGATCCACTGCGTGCACAGGCAAGATGGGGCTCAAGCGATCCAAAATGCCCTCA
TTCAATCCTCGAGCGGTTGTGGGCATCGCGAAGGCTAAGAAGCAGGTTCCTGTTGACGAGGAATCTCCCGAACTGAAGCGCCCCGTTCATTTGACTTCGT
TGGCACTGCTTAAAAGTGCTCAGATGGACGATAGCTGGCTGGAGTACTACGGGTTTAAGAATCGTCGTTTATTTCTCAGTCATCGAACGCGCCGACCGAA
AAAGGCGGATTATGGTGAAACCGAGAACATCAGAGAGGTTCGCCGTAGCCCAGTGCCTTCAGAGTGCTCAGCAACGACGGAAGAGGATTTATCGCTCACA
CCGCCACAGACAACTCCGGACAATCTCGTCGAAGATAAGCCACGGAATTGGAACTGGTACGAGAACGTGATAGCAGGAGAACACTTGCCTCAGATGAGAT
CTCTTCACAGCTACATCTGCGGTGGCAAGTCAGATTGGACAGCAGATCTCAGGAGAGATCTTATGCTTGCGGTCGTTTCCCCGTTGCCAGTCGAGAAGAG
GGGACCGGGTCGCCCCCCTAAGAAGCGCGGCCGTCCTAAGAAGGTGGTATCAATTCTTGCTCAACCTAGGCGTTCTCCTGTGGGAACGAAACTCATCCAC
AGACGACTAGGCCTCTCACAAGCACGAGCACGTGGCATAAATGAGATTGCGGCGTTTGCAGAAGGCAAGTCCAAGTGGAACAGGCGCGTTCCGTCCTCCA
AGTCTATCGACCCAGACCGCATTCGCCGTTTGATCGATCGCGTGAAGGGTAAGCAGATCTTCGTCAACACTGACCAGGTAAGTTTTATGGTTGCTGGCtg
acgcgcttcttgctACGGACCATTCCACTGACATTCACCGTTTAATGTGTAGAACGACCTAAACGAAGATGTCTGCTTCCGCTGCGGCCTAGCGGGCGAG
CTGATTTGCTGTGATGGCTGCCCGGCCGCTTTCCATCTCAACTGCACAAACCTCGCCATGGTGCCTCCGGATGGTATTCCATGGTTCTGTTCGGAATGCA
CAAACCCGAAGCATCTTCAGAAGGCTTCAGAGATGCCCGACACAGTTACCACCTCTGGTAAAggcacaagaagcagcagccgtaCGACTCCAACAGATTA
CGCAAGCCGCCACTTGCGCACACACGCAACTCAGCAGGTTCCGAGTCTCAAGAAGATTTTTCACTCCACGGTGCAACATACCAAGCGCCGCTACAAGAAG
CGGCATAAACCCACGGACCGTTCCTATCGTGAGCTGGAGCACATGCCATTGCCTGTCTGGAACGAGAGCGGCGAGAGCGAAACCGAGCAGTAGCAGGCAG
CTGAGAAGACTGCAGAAGTGCGGCCAATTTGTCCATTTTGGGGGGTGGTCGCGTTCATTTTCCAAGGCTGTCACGCGCACAGAAGTGTCGACATTGTACC
TTTGTCTCTAGCATTTTTGGTCTTCTCATCATCAAGACCTTAGAAACTGAATGAAAATAATAACACGCATGTTTGTTAAAAAGTAGAAAGTGTACTGTAG
TAGATGCCTTCTCATTATTGGTTGTAGAGTTTCGCCGGCACAGGGCCTTCAGCACGGTCCTTGAGGAATCCCTCGCTGTCTTCTTTAGCTCGCTGCAGTA
CAACGAAATTGCAATGGTCATTAGTTAAGGAAAAATCTATTGCGTAGTACCAAATATTGCATTTGGAGACGACGATACCTTGATGGAGGTGACCAAAGCA
GCGTAGGGCCCCGTCGACTTGAGCTCGGGCATGGGGTTGCCGCCGTCCATCTTGCCTGTGTATGAGTggttgagcttctcctctcCGGGAGGCGGCGCGT
ACTCGTTGGACGCCTCGGTGCCGCTCGGGAAGCTCTCGAACGAGTGCACCACCTCGCCGTGGAACTTGTACGTCGCCTTCATGCCACTCATGGGTGCGGT
GCTGGTGAATTGTAAAAAGTGACGCTTTCTAAAAATTTTGTTACAGTTAAAGATCATCACGCCACTATTTCGTCTGTAGGAAGAACCTAGGTTCCAAGCT
AGAAACGCTATTCTCTGCCTATTTCGCGAATTGCTATCACGatgaacgcgctgctgggAGAGCTGCGCATGgtcaaggtgctgcatcagcaaTCGGGTGT
GTGTCTGTTCACGCATCAGTGGAAGTGGAACCCGCAGGCGCACGCAGAGGGCGTCGATGCGCTCGTCATGTCCTTCACGCAGTTCGCGCGCGAGATCGAC
GGTGGAGGTGCGGTCTGTCTGATGACCAGTTTAATATGGATTACTATATGTGCTCTCTAACTGTGTGACTGTTGATTATTAAAGAGGTCGTCCAAGTGCA
CTTCGACCCAAGCAGAACAGACAAGAAGGACCGATCAAACAGCAGCCCGATGCCTGTAAGAGCAAGATACCCCTTTAGAAGGGATCAAGTGATGATATTG
AATTGGGGTTTTCATTGTGCAGGCTTCTTCAGGTGGTCTAGTCATGATATCGCTCCAGAACGAGACCATCCAAGCAGTTTTGTTCCATGACCGGACTTCT
GATGCAGCGTGCGCCGCACTAAAGTCATTTCTGCAACGAATCTTAGAGCGGTTTGCTGAGGTGTTcgagcacgagctggagcagttgcAGCCCCAGTTGC
AAGCCAGCGCCACACCCACCGCCGAGGAGGTAAACTGGTCTCGCGATACTTGTTCATGATGCTGTTTCCCTAAATTCTGTCGGTCTTTGTGGCTCTTATT
TGCAGCGTGAAACCGTTGAGGCCCCATTCCGGAGATTCGAAGCGGAGCTTGACAGTCAATTGCTACCACAACCTAATGGAGACATTGGGTTGCATTAAAC
CCATCGCCCGCAATTTTTTTGCCAGGATACATTACTAGACGACACGGAGTCGTTATCGCCGGGGACGACTCGCGTCGCTGCTTTTCACTACTTGTACTAC
GCCCAGATTTATAGAGTAAATAATATGCTGTTGTCAGCCTTGCCCTCCGTAGCTACTAGTCCAATACACTTTTTCTGTGTCGCTCACCAAGTTCAACGGG
TTTGTCTCCGGTAGTGAAGCCCCACAGCTCGACTTGAACACAAGAAAACTCTTGTGAGGTGGTTAGTGGTGGCGAGTTAAACGTTTCGCAGGCCCCGCTT
GACCCTGCAGATAAATCGCTATCCTGAAAAGCAGAGAAGCAGAGATTGTTAGTGAAAGTATCCAAAAAAGATGACAAGCAAGCGTACTCACCAGAAACAA
ACCAaagttgccgccgccacccATGATCAACGACTCCTCCGAGCATAGCATGAAGTAGCTATTCTTGCGGCTCCATTGGTACTTCACGAACCCCCCTGCA
GCTTTGGGGTTTGCGAAGGTAAACAAGAATGATTCGCCAGTTCCGTAATACTGGAATGCGTGATGCCACTCGTCTGATGCGAATCCGCCAAACACATTTT
CCTTGGCGTCCTTGACCACCAGCAACGTCGGGCTTTGCTTTTTCGCGAGTAAGAGCAGTGTCTCCAACGAGGATCCATTTGCCTCGACGCTGTAGATTCG
AAACCACCGGCCCAGTTGACTCGTGATGGGCAACGCAGGATCAATATACGCGATGTGTTCCAGCGTCAAAATGCTAGACGTGTCCATCAACTTGGAGTTG
TAGTCTTCCGGATTAAAATGGAATGagggcttcttcttggagtgGCGCAATGGAGGTGACAGTAGTGACGGGTCTGAAAGTGCAGCAATCCTGAccgctt
cagcttcgaccGACTCTCCCGGCTCTTCTagttcctcctcttcctgttctgcttcttcctcaaGGCGGCGTGCCTTTATGGCGTCCCATTCCACTCGCAG
GTCCCTCACAGTTATGGgagccttcttcagcaactcGTTCATGATTCCCTCAGTCTCAGTAATTACACGAGTGAAGGACGCCGCCTTTGGATCAAGCCCA
CTCCAGAGTTGGTCGAACACCTGGAACATGAACATGAACAACTTGCTGAAGTACATGTCTTCGTCAAACAGCTCCCAGAACGGTTCCAATGACATAGCCA
CGATGTCTATCTCAGGGTGCTTCGGGgtcaagctgcaggtgcaAACAGAAACGTCAGTTTATAATGAAATATCAGCgcacaaagcagcaaaatcaCGACG
TACTATAAATTCAGGAGCTTCACCAACGATTCGCAgattgacgacgacaccagGCCTGCGTCGTAAGATGGCAACTCTGATGGCAGTGCACGCATCTTTA
GTAGAGATAGCGCATCTGGGTCATTTTTCAGCCAGTACAAAATGGCCCGCAGGATCAGGACTCCACCCTTATCAAAATTCCCCAGGATTGTTGGCCTGTT
AAAACCGAACTGTTCCCAAATGCTTACAAGGTCTTGCTCTGGTGTTTCGCTggttgttggcgaagatTCTCCGCTGCTCGTAGGGCtggttggtggcgtc
gcaaCTGCCGGTCCGCGCAAGTCTAGTTCCAAGGTAACGGCAGAGCTTTCCTGAGACTCATTCTCCGGATCTGCTGAAAGTTCTGCCTTCAAGCGCTGCT
CAACGGTCGAATCGTTTGGTGCAGATGTTGAGGAACTGTCACCTCCTTCTAAATGTCCGCGAAACAACCGAGTGACCTCGTTCACCTGCTGCCTATCTGA
CAAGAAATTCATCTGTGGTTGGAGCTTCATCTGATGAGACACCATGCGAAGTGCGTCCTTTTTGGCCTCCAAGCGCTCAAGTGCATCTACAACCTGCACA
CGGACATCATGAAAAATGGCCGCATAGTGCTGAATCATCCGCTCCACTACTTGGGCACCCACTGCTGCATACCTTACGTCTTGATACTGAGAATGGGTTC
TGCCACGTGGTCGTTCGGACGGCAAACTACTTGCAGTTTCTTTCTTGAATGCAATCACAGGAGCTAGAACAGAAGAGGCTGTGAATATGTCCACGCCATT
TTGTTCGGTATACTCCGGCTGTTGCAGGAAGTTCATAAGATTCATCACTCTCTTCAATACGATCTGGCAGTGTACAGGCAAGTCATTCACCAAGCACGTG
ATGTTTCGAATACTTGCATCTTCGTCACGCAATTGCCCGGCTGCCACAAACGCATCATATTTGTCATCCGTCAGCAACGAGTCTGGCAGGTTCTTCAGGA
AATCCAAGAGCAGTGCACCGGCACATTGCGGATCCAGATTTTTCGGTACGGACCCCTCGGTCTCCACAATTTCTCGGAGCTGGTTCAAACGAATGCTTAG
CACTGTTGTTCGAAATAATCGCGGAGTATCCGGGTTTTCCCTCAGTATTGCAACACAATCGCTCACAATATTAGGAATTGCTAGCAGCGGGTCAATGAGA
GCGTAGCGACTGTGATATGGGTTCTTCGAAAGCGAGCCCAAACTGATGCCGAACACGTACTGCCACGGCTTAATCCCTTTGAGGCGATGAGGAAACAGGG
CTGAAGGTAACTGGAtaacctcctcctcctctgcatcCGCGATAGTCACAGCACCTTGGATCTCCAGGTCTTTCACTTCTTCAATTTCGACTAATACCGG
CTCGACACCTGGAAGTGGTAAAAACGATCCAGCTCTTGAAGGCGACACccccactgcagcagcaatatctTCATCCGTGATAGTAGATACCATTTCTCCA
CTATTGGCTTCAGTAACAGGTTCCGTCTCCACTACTTCCACAGTCTCCGCCAACTCAAATGGTTTTCCGCTGACTTCGATAGCAAAGTGTACTTCACGAA
GAGCGATAACCAGCTCAAGAAACAAACCCAGGCCTTCAGAGCAACGGACGAGTGACCACTCTTCGTAATTAGTGTGGATCAGGTGCTCGCACgccatgga
gaagatcatcTACCATTCACACAATTTAAGACAATAATTAGCTGTGAGGAGCTTGCAAGACGACACAAAAGCACAGGCTGTTAGCGCCTACCATTATACT
CGACTCAATGGTATGATTATTCAGCGCGATCTTCAACCAGCAACGTGCCTTCCCCACGTCAGTCTGTCACAATCACCATAACCTCCGTCAATCAATGCAA
CAACCAACAACTCCCTTCGAATCATCAAAATGCAAGCACAAACCTCCGACAGGAATGCAGCAGACAGCACACTCTGCACCAGCGTCGGTTCGTCCACAAT
GAGTGCGCTGGCATGCAGTACGTTCCACCAGGACGACTgttcttcgtcgctgcgtggCTTGAGCCCCAACACCAAACACTCCTCCAGTGCCATACCTGTC
CACAATCCATAATTATCAACTTTTCCTCAACAAATacaccactgcaacaacgTACAAAGCTCGCCGACACAAGGGTCGCGCTCAGTTAATAGTTGACGCT
GTTCTCTGGGCAACGTCACTTCCCCCAAGGCTTCCACCTGACCAGAAACCAGCTGATCACCGCCTGCATCACTTAATTCCGCTGCGTTTTCCTTGCGTAG
CACCGTCAACGTGGCGTTCTTCAGCCGCGTCTGCAATAAAAATTAATCCTTAACATTATCAGATGTCCCATCTCGAAAGACGCCGAACTGCAACAACGCT
AAGACGTACCAGTGCGTCGTAGCGTTGTTGCACGAAGACTCCATTGGCGCCTCCCTTGTCCTCGTGCCGCGTGGCCAGCCAGTGCGTGATCCTGCTCAGC
ATCTCGCCGTCTACAGACTGGTTCACGGGCCTGCCTCAACTTTTTCGTCCTAAAAATAAATATAAACCGTTGGATGCTGTGATTGGTCCAAAACAGAGTA
AAAAATATTTGCCATTTCTGGCAAATAAGTTTTGGCATCAATCCCAGAAAATGGCACGGGACTTGGCGTCGCCCTCGCCGATGCGGGCGCGATCTCTGCA
TGCCGCAATGGAAGAGGCTTCGTCTCCTCGTGTGGACAAGACGCTGAGCTTCATgagcagtgacgacgacgacgagaacgaagaaaaacaagagCAGGAA
AATAACGACAGCAATTATGATATAACTTGTGGTCGAGGTCTCAATAATGACGACAAAGCCGCGAAGCCTGGAGGAACCTTTCGCTATCGTACACGTCGTA
TGGAACGTCTGGACGTGTACGGGAGACAGGACCCGCCGTATCGTCGACGCGTATTGCAGTCGCCCAataaacagcagcaacggcgatCCAGTTCCGAGCA
GAGcacgccgtcgtcgcacAGGAGACTTTTAGGGATGGCGACGAGGTGCGTTgcggcaagttgaagagctTTTTTAATTCTGTGACTTAGTGTAATGTGG
TGTTTTGCGGTCTATGTAGATGCAGTCGATCGGTGTCGCCGCCATGTGcaagtccagcaacttcGCTGAGTCATAATTTAGGATCGACGTTGTCTATGTC
GAGTCCAGTGGCGATTCGGAGGCGGCAGCAATTGAAGAGAGTAGTGCTGAAAAGACTTTTTATTGCCGACTGTCCGGTGGGTCATTTGGCATGGTTGATA
TGAGGCTGTCTATTACTGACGGTGTTTCTGTTGAACAGAACCACTTTGTGAAATCCtttgacgagctgcagacgctgcggTGGCTTGGTGCAGGCGTGTC
AGCGGAAGTTCTTAAGGTATTGCTTCGAAATACTGTTTGTCCTGTTATTCAGATAATGTGGCGATTAATGATTCCTTTTTGTGACTGTATTGCAACTTGC
AGGTGAGAGATCCAAACGGTGGAGGTCTTTTTGCTATAAAGAAGTCCAAACAAGAACTACGAAATGATCGAGAACGGTACGGTTTCGCTAAGACCAATGC
TCTATGGACTGGTGCTGATTGACTTTCAACATGTTAACTCTGGAACTTGTGCAACAGTGACCTATTGGCTCAAGAAATTACCGTTCTAGAAAAATTAACC
GCGTCACGACACAACTTTGATAACATTGTGCGGTATTATCAGGCGTGGCAGGAGAACGGTAAGCCACTCGTTTATATGGGCAGATACTACTGTGTCGACG
CTAATTGTCTGCGCAGGTTTCTTTTTTATACAAATGGAATTGTGCGAGGGCGGCACGTTGCGAGATTTTATGACGATGCGGGATCGAGAAACACTCCCCG
AAAGCTATGCGTGGCGTATTCTCAGGGACGTTGCAAGTGGACTGAAAGTCCTCCACGAGCACGACATTGTTCATCTTGACATTAAACCCGACAACATATT
TATCACCGAAGACGGTCAATTAAAGATTGGTGACTTTGGTATGGCTGGGAATGTGGTAACATCCAAGAAATCGTCAAACCAGAGGGATCTCGAAGGGGAC
GCAAAGTACATGCCGAAGGAGCTGCTTTCCAGTGCTAATCGACTGCCATCCGCGGATATCTTCTGTCTTGGTAAGCTGAAAAGTTCAAGGTCCTCAACTG
TTTGCTGGAGCTAACGCGGCTGATTCGATGGTCCAGGTATCATGCTGCTAGAAATCGCTACAGGAGTTGCGCTGCCAGACGCTGGGAAGCAGTGGCATGA
CtttcgagaaggagatctACCTCCATTTTCGCCGGAGTATTCGGAGGAGCTCAGCGCGGCAATCCGAAAGGTGCAAAATGTTCGTATTGTTGCAATGATA
TCTGTTGCTAACTTGCTGTGTTCATGGCTGCAGATGATGCATCCCGATCCGACAAAGCGAcctactgctgcagccatcCTGAAGAACCCTCGCGTAAAAA
CTGCGACTGAGCCTGCTACTCTCATCCTTGAGGTACTTaagagcagcaacttttTTTCTCTACAGCTCCAGTTCCGTCTAACATCTGTATGCTTCCGTCT
GACAGCATGCGCTGAAGCaaaagctggtggtgcccaCCAAGGTGCGCAACACGAGGCGATCGGCCAGAAACAGTCTGCAGACTCCACACAAGTCGCGCCT
CTCGATGCCTTGATCTGATtggcttcaacatcgtcgacTTCAGCACAATatggtacactgtaccatCTATTGTTGAACCGGTCCAAGCATCTACCCTAAC
CCGAACCGCCTGCATTAACCGCCAAAATTGAACTCCATCGCCCACGTTTTGGTTGGCTTCGAGCCTTCGATCGCCCCGCCTGCTTCAGTATCTCTTTTCT
CACGTGATAACAAGAGtacgtcgctgtcgctatGTCAATATGCCCTGAATCAACAGCTCAATGGTGCTAACTACCAACGTGCTGCGCCTGGTGAAAATTT
ACAGTGAAGTTCAACTCGACCGTGTCCTCGTCGCGCCGCAAAAGCCGCAAGGCCCACTTCGGCGCCCACTCGACTCAGCGTCGTGTGCTCATGAGCGCAC
CTCTgtccaaggagctgcagaacaagTACAATGTAAGTTAGTACACTGGTACTTTCAGCGCTGTAAGTCCATGTCAGACTCTGCCCCGCTCTTCGCTCTT
AATAGAGAGAAAGGGAGGGCAGACTGGCACTTCATGGCATCGCGGGAACCGTAAGTGTCGACCCCTTCGTCACaggacgacagcagcacaacaacagcaa
caccaagtcGATAGTGTGATATTTACGTTATGAACCTGTTGTAATTGCCAAATTCCAGGTTCGCAGCCTGCCCATCcgcaaggaggacgaggtcaTGATC
GTGCGTGGCTCGCAGAAGTCCCGTGAGGGCCGCGTGACCGCCGTGTACCGCAAGAAGTTTGTCATCCACGTCGAGCGTGTGGTGCGCGAGAAGGCCAACG
GCGCCTCGGTGCCCATTGGCATTGACGCCTCCAAGGTGGTCatcaccaagctcaagcttGACAAGGACCGCAAGAAGATCCTGGAGCGCAAGAACCGCGC
CGTGTCTGAGACCGAGAAGGGCAAGTTCACGGAGCAGGACGTCGCCATGGCCAACGTCGACTAAGTTGACTAAAACTACTGCTATCTCGAGCATTGTTAT
CGTACAGAGAGGGAAAGACACACTAAGGATGGCAGATGCCACACGACTCAGGGTTAAAAGTAATGCAGAATCGTGTGGAGCTCGTCTCCTTGGCATTTGT
CGACTACTAGTTATTATGACGGCAGCTTgttcatctcctcctcgatcatCTGCTTTAGGGAGACTGTAGGTTGGTCCGACACTagttcgacgagaaggtt
GATGAAGTCCACTTCACGCTCGGAGAATTCCCGTAGTGACAGTTCTTGCATCTCGAGACGACGCAGTAATTTGGTGCAGAGCGGCACTGCTTGTGGAAGT
GAACGTTTGACGGCTGCGAGCAACTTGTCTTCGCATTCGCGAGCGTACTGGTCTCGAATCCAACTCTCTTTGCTTCCCGAGGATGATTGACCATGGCGCC
GTAGTTTGTTCATGCGATCGCCGTGTTTTTCAACAAAGCGGTCGAGCATtgacgccttcttcttctcctgtgTACGGCAGCAAACAACCATCAATACACT
TCAGCATCGGGCTGCATGTGTAGAAGTGCCATCACGTACATTTTCGAGCGAGGCGAGATACATTCTGGTGGCAAGGAGCTCTTCAGTTGAGGCAGCCTTC
TcttgcagcaatttctcGTTCTCAAGATGCAATTGATCCGCTTTTTCAAGAGCCTGGTTCATTTCTGCGTTCAAGCGTTGCTTACTCAGTCGAGCTGCAA
CCAGATCCTCTTCCTTGTTATTCAGGTCTCTGAAAGCAGCGCGTCAAGCAAACTGTTAGCTATGCCAGGTACTTCTTTGAAAACATTCCTAAGAACAACT
AATGAATTCCAGAACGTACCGTGATAATTGGTCTACACGTCGAGTGGACTCGCCCGCCATCCGACTGTTAACTTGGTGGTACCTACCGTCCGCCGCCAGC
AATCACAGGTTAGGACAAATTCAAGAAATCTCTGCCTGATCGCAAAGCGAACCTTTCTTTCCGTCGATACTCCATCACTTCTCGTTCTAGCGCCAACTTT
TCTTCAACCACTTGTTGGTATTTCTTTTTAAAATCAGTTGAAGAAGGCCCACCCGATCTAACCACGATACCTCCTCTTCCATCTGAACTACTTCCCTAGG
TTTCATTCAAAACGTTCGATTAGTCGCTAATAGTATTATACATCGACAGAATAACTGAGCCCTTACCTTGAGCTCAAGCGCGACATTCCGTGCTTGTAGC
TCTTGTACCTGAGCATGAAACGTGCGCAACTCCTGCTCATATTGCTCAAACAGTGTAGGCAGAGACGTGCGGTTCTCTAGAGCGCGTACTTTGCTCCGAA
GTCCGACATTTGCCAACTTCATGTTTTCAATTTGAACTTCGAACATTGCAcgaagttcttcttggtcttgcagtGCCTCagctgcacgagcttctgctgc
ctctttagcttgttgttgctcgcGAACAATTGAGAGCAGCGCATCGTAATTCTTGCGCAGTAACGTTGCATCGGCAGCTTGAACTTTTTGAGCAGTCTTG
ACATCCAAGCCATCAAGCTTCGGAGGCTCCATCACGCAGCGAGAAATGCCTGCCTTCTTGAACGCTGGCAACGTGAAAACATCGGGCTTTGAAGGCacgg
ctgaagaagcaggaatTGGCACGGGTGTGTCAGTTAATGCGGGCATCTCTTTATGTTCACCCAAGTCCACTTCAGGGCTACCGCTTGTGACCTCATCATA
GCGAGGAGTAGAGCAGTCGATGGGACGATTACTTGCCGCGTAATTGGTTTGATTCCATGAAGTTGGCACTTCGtcattttgctgctcaagttgGTGTCGT
GTAATCCCTCCCATGGTGTTTCTGCTATACCCGACCTCCACAGAGATttcttcattgtcgtctTGATCAGCAATCGGGAGTGGTGCATGAGGCTCGGGCA
CTAAGCGATCAGGAGGTAAGGAGTGAAGCGAACAATATGATGTTCGTGGACTCACTGATCTTGccagctcgatctccttTACATCCTCTAAAGACTCGCG
CAACTGCTCGTATAGATCATTGATTGACGGCCGAGTTTCTGGTATGATGAAATTCTGCTCcaactcttcttcttctcgaccaTCAATGCCTGACAAGGGT
GCATCCATGACAGGGTTTTCAGGATTTCTGATTGTTGGTGCCATCGTGTCAACTGTGCCAATAGAACCACCGAGTATGTCTCGCTTCCGCTGTGCAAATG
CGCTCAACCAGCTCATAGCTTCAGACTCAGCGTGTGCACCATTAGAGGATGGTGGTTGTTCAGATAAAAACTGGTGTGCCAACGTTtgagaagcaaaaga
aaCCGCAGATTGGGACACACAAAGAGGGGGTGAAGACGCGGGGTGACTCAACGCAGACCCAACTGCCGAGTTCGAGACAAATGGCGTTTTTAAAACCTGC
TCACCTTGGCTTGAAAACTCTTGTCGCTCGGACTCCTTCGAACTGGCTTGGAAATCCAGTTGGTCAAAGGAAACACCACGAAGTGGTTTGCACACACATG
CGAAGCCTCGAAGGTTAGCCATGGCATTCATCATTTGCACGCTTTCTCGCAAACTAGAGCGGGAGTCGATCACGTTTGCGTAGAAGAAAGTTTTCGCATT
CGCTGTCAGCAGTGGTAGCATGAAATTGGACAGCACTGTTTTCCCTGCAGGAACACCAACGCAACTACCGCTTCGTCTCGGGGAGGGTGCGGATTGTCTT
AGGCCATGCAAAATATTGTAAAGCTCGAGCTTTTCTTGAACCAAGATGTGTTCCTGGAAATCCTTCTGGTCGATGAGATCAACAAGATGCACCGTGCTGA
CCTGGCCATCATGAAACAACGCCAAACGTACGAAAAAGTGGACACTTTCTGCGTTCTGCTTGCGCACGATACGGTTGGTCTTTGCAGTCTGCACAATGCG
AAACGCTGCAGCCAAAGATGAAGCTTCCAGCGAAACAAACGACAACGGTTCGACTTGGCTTCCTGCATTAATTGGTGCCACCGCAATCGCAGTCGGGGTC
TTCAGTACATCAATCGCTTGGTTGTTCACAATGATCCAGCTGCTAATTCCCAGTCGCCATGGTTCAGTTTCATGATCCTGGGGGCGTTGAGACCCCAAAT
CCAATCGAGAGAAGAATGCATGAAGCATTCCCACAAGTTGACCGTACAGGTCTACGACGTCGTCTAACGCCATCTCAGGTTGAGGTGCGAAGCCCCCTTC
GCCAACACTTTTGCCAAACAACAGCCGGAATTTTTGTGTGGGATGCACACCCCACAAGACAACATTCGAATTGATACCATCTCGAGCAGTTCTCAGAGCT
GGCAACGTGATCTCGGTGAAAAAGTCAACGGCGTGCGAAGACGAACTTGACGAAAACACCGAATTGAACTCCCAATCGGCCGAAGGACCCGCACCAGATA
AAATCGCTCCTGCAGGTGCTCCACCACCTGAAGAAACCCCCGAGGGTGAATCAATAGTAGACTTGTTCGTGACTCGCACGCAATTCTGTAGCGGAACTAC
CTCGAACACTGGTGTTGCGCGATTTGCAGCAGTGACATAGCATGAGACGTGGATCTGGCTGAGCACAGGAGCATCATTTGAGTTTTCTTCAACAGAGCAT
CCGCTCCTCTTGGCATCGCCGCTGTAGTTTCTTGTGCTGCCACCTCGCTCCGACATCACCACGAAAGAAGACGTCCGTTCACTGACACATTTAAATAAGA
TAAAAACGCCCAAACATAACAACTTCTACAACGCAACACCTCGTAAACCAACAACGAATTCATAAAATAAAAATCAAACGCACCGCTGCAATCCGCTGGA
TGCCGAATGCCGCGAGCTGCGCTCCAATAATGACTTTCCTGCTCCCTCGAGTTCGCTTCtcctgtcgctgctgcccatATGCTACCTACCGATACACCAG
AGGCCCCCTTCGGTCTCTGGTCACTCTAGATTACATTATACTTTCTTGATGTGTGTTGCAACCGCAGCCACCATGGCGCGGAAGGTGATGGTGTCTTGGC
GTGAAAACAAAATGCTGAACTCCGATTTTTGAGTAGCCTCGACAGATATGATTcacggctgcagctcgcacgcggcaagctgcttcgtcgcgTCCTCGAA
TGTCGGGGCTTCGAAGGCTGGTCGCAAGAGAGAAAGCGCACGGGAGCCGCCATCCATGAATGCCATCTCAGCGGGTTCCTCGTTGATTTCCTCCATGATA
CTGTCCTCCAGGATTTCCGATCGCTCAAGCGGCATGTGCATGTCTGTCTTGCGGCCAACGGTTTCAACAAGTTCGTCAAATAGCCCGATCTTCCATGCGA
GATGTTTCTCCTCCAAGAAGTACCATACGCGGTATGCGTTCCAGAAGTGTGCGTTGTCCAACTTCTTTACAAGTGCACCGTTTACCGAGTCGCGGAACAC
CTTCTCGATTCGCTGCACGTCGACGTCTACATCGCTCATGTCTACGCCGTTGTTCACAAGAAAgcgcaacagcaccagcagttCGTACTCGGACGGCCGG
TAGTGACCGCTGTGGGGATAAATAGTTTTAATGACCCCGTCAGTGATCACCATCATGCCTGCTGTCTGGACGCACTCGCCTCCCACGAAACTCGTATGGT
GGATTCGAGggatcttcttcgtctccttctgTGAGCCGTAGAGAACGCCATCGCGTAGAACAAAAATCCACCCATCCGGCCCTGTTTCGACAATCTCTTG
TGTGGCATCATGTACAATCACGCCGTTCTGTACCGAGAGCGCAAACTTCTgacgctcagcagcagtgtcACAATAGAGCACAGTCTCCCGCTCAAGTTTC
GTTCTCGGGACTCCAGCGACTTCGATAGATTCATCGTCCAGCCACTCCCAGAAGCTCGGCTTCGTGGGCTCCATCGGCTGACGCTTCCACTCCTTATAAT
ACGCTCGCAAATTCGCTCCATACCTATCCGAACAAAGCACTGCTGTGAATGCAACTGTTGAACGATCCTCAAGAGAGACAACGAACTTACCGGTGCTTGC
GGTCGCAGACTTCCAGCCAGCTCTTCTTATCCACGACAGAAATGTTTCCTGCACTGTAGCCTTTCACCAGCTTGGGCGAgtacttcttggccaactTGAC
GATCTCGTGCATGTTTTGGTAAGTGGTTCGTCGTTTGGCACGCATGCCCTCAACTGTCATTTGTTTGGCTCCGCCGGTCGTAAAAACTGCTAGTTTCTTT
GCAGTTATCAGCCGACTCCTGTCACTTGCTCGGACTCGCTCTCCTGtgtctctgctgctgtcgtcgccacGGTGCCGTCTTTCAGTAGTTCGTATCTCAA
CTACCTACTAAACCAAGAGCCTCTGTGGGTTGTGTGTGTGCGCACGCGTGCAAGTGGCAATTGCAATTGGAATTGGTAGCAAGCCAGTCGGTTCCTCTGT
CCAGCGAactgcaagagcagcaagtgggATACACAGAAAGGGAACAAGACACGCCACTTCTCGCAGCGCTTTGGGTACGCGAGGGGCGATGGACAAACGG
CACAAAAGGAGCTCGTGCACAAACGGCTTTTTTTAGGCGTGTGCGTTCGCTCGGCAACTTGTTTTGTGTAGGTGGGGTGGGGTGGGGTGAGGGAACTAGC
TCTCTCACTCCTGGCAATAGGCTTAAAAGCGACAAATGCACTACTGCAACGGGTAACAAATGAGAAAAAAGAAGCAAACGAACACAAATGCATAGACGTT
AGTCGGCAGAGTTAGTCGTCGGAGTGTCCGTGAGCCCAGCTGCGAAAAAAGCTTACCACACAAACTCTCGTTCTGATCCGTACCTGTTGCTTCTTTCTGG
GTCGACGCTTCTCTCCTACGACGCAAATTCTCTAATGATCGAGAGCAACCGACCAAAAACTGGAGTTTTGGGGTTTGCCGCACAGACCCGGCTATGTGCA
TAAAAAGCCTACTCTCTGGCCTCAGCGGCGATTCGCGGTTCTCCTTAGCCAATCACAGATCTAGAACATGGTTGTAGCCAATGGCACGACATTATAGTAT
TTGATTTCGGCCAATCCGAGGCAATTGGAACTACAACCCTAACCGGTCCGGTTTGCCGAACCGGGCAATTTCGTCGAGAATGTTGCAGAACTGCATGGGC
GTTCGTTGCTTGGGGTCGGGCGGCACATCATGACTGGCCTCTTGCCGGCGGCGGCACCATTTTttcatgaagcagcaggtgtcgtcttcttcttggaggt
CCTCGCCCCAAAGATTCGTCTCAAATTTGTTTAGGCATCCGCGAGATTCGGCGCCTGCAACTGGACGATCTCGCTGCTCTCCGACACCGAATGCAGCGCA
CAACCAAAGCGCTTGGACGAACGCGTCCACGCGGCAGTTGCAGTTGGGCGGCCCACGCACGACTATGGAGGATAAGACCTCCGCCAGGTCCGCCCACCGA
GACTCAATACGGCTGCCCGCTCTGTAGGTGACTCGCCCAAgcgctgcgctgcgctgcgaTGCTACGTcagaaaagcagcaacaacactgTCGAAAAGTGG
TGATGTCTCCGCTGCTGGCACCGCACCGCACGGTCGCTCTTGGAGTCTGCGCCGGGCTCCGCAGCGAGTTTTGCACTGGCTGTGTATCCCCTCGTCTGGT
CCCACCCGCGCCGCCCATCCAAAACTCGTGATCGCGGCCAAAACCcagacggcgacgagcgcCGAGACGCCGCAGACGTGAAAGGCAACAAGCAGGCAGG
CAACGCATTGAGGTCGTCACGGAATGGTGGTGTGTTGCGCGCGACGCGTCACGATCTTCACTACGAACAGATGGCTGCATATATCGCTTCTTCGTGAGAC
CGACATGAGATCGTCGGGACAGCGCTCTCTATCTCTTGGTGCTTGGTTGAATGCTGTGGCAGTTTCCGTAACGGGCGATGAAGCGGTCGACGCGGAAATT
TGCAAGTACAGCGAggtgtccagcagcagcagcagtgtgtgTAGCACGGAGTATTGAGGGCTCtgtctccgtcgcctccacagcttctgctgccagcgac
tcggagcagtacgacgacgacttcgacgactacTCGGACTCGTTCGAGTCGGACAACGATGGCACAAACCCCGATGCGCCTGTGGTGTTAGCAGCTTCCG
GCTCGACAGAACAAGGCCTGCTTCACGTCGGGACGCGCGTGCAGGTCTTTTGGAGAGAGGAGAACGATTGGTTCGACGGGGAAATTCAAAGGGTCGAGGT
GGGCAATGAACCTCGTTGTTACGTGCATTACGTCGACGGAGAACAGCAATGGGAGGTGCGTTAGAGTTGAGGCGTGGATCAACCCATGAGATTATCGCAC
TTATGCTGTCTCGTGGTGCTTGCTTTAGGATCCATCAAATATCCGTCCATTGCCCGCTGACATCACTTCCGTGGATGAATACGATCAATTACAACAGCTC
TTGCCACTGGGTACGCAACGAGCCCAAGCGATAATAGGACAAAGAGCCATGGTTTACTGGCAGGACGAAGCTGAATGGTACAGCGGCGTCGTCAGTGCTG
CTCAAGCCTCACCACCGGCGCTGAAGATCGAATACGACGACGGTGATAGTCGCTGGGAGCAGGTAAGGAAGAGTGCAATTCGTGTCTTGGTTCCTCTCAC
TCACCTTCCCACGCTCGTCATGTAGGAGCGCGTGTTCAATTGCATCCTCCTACAGCAAaaagaagttgaagctccAAAACCTTCATCATCCACCGCTGAT
CCCCCGTTATCTTCTTCAACTCCACTGTCGCCGCCTCAGCGAGTGTTGTACGCTCGTCCTTACCGACAAGCTGTTAGCGACCATTTCCAACCTGTTCGCT
TCGCTCGGCCGTACCGCTGTGCAGTTGAGAAACACACCAAGTCGGTGATCACTCCACGGATCTCCTATAGTGAACGCAGATACCTTCATGTCGTCCATGA
TGCTCTCGAATGCTTTCACTGCGACCAACACATAGCACCCGAATCGATGCACATTGATAAAGTTGACAGCATCGTACAGACGACGTTGCCTTCGTGCCTC
ACCGAATCTTCATCTTTACATTGAAAACAGTTTATGCATTTTTCCGACCACGAACCGATTTAAGCACCTTTTTGATCGATGCATGTCCAAACGTGGACTG
GTCGGCTCGACTGGAAGACGCTGCCTCAACATCACTGTCCACGTTCTCATCCTCTGAAAACGCGTAGCCATGGTACTGGCCCGGGGTCCCAATAAATGAT
GACGAGCGGGATCCGACTGCTACATTCGCAGCAACAGTGCCAGAGCCCACGAAGGATGACTCCACATCTGAGCCAAAGGCGTCACCGCTACCTGTGGCGT
GAAACGATCCACGAATGCGAATGTTACGCTTCTTCTCTCGACCTTGAAATCCAACCGCATGATCAGGGTCGACGGTGTCTCCACCACTAGACGAACCGGA
AAATGGGGAAGCGATTAACCTCTCGCCAAGCGGAGACGAACGCATGAGCGTTTCCTCCGGACTTTCCAAACGCGGGATATTGTTGAACAGCTTTGTGTAG
TCCACGACAGTAGCTGGCACGTCAGTCCATGCCGTACTTGACACTGATCGTCGATGCTCGCGAAGCATACCACGAGGCGAGTTTGGCAAACCCATGAGCT
CGCGCTCCTGGAGAATGTGGTACATTGATGGTAGCGAAAACCGGCGCACAATCTTCCACAGTGCATCACGCAACAGGCTCAACGATAGCACAAGTAGGCA
CACAAGCCAGAAAGTAGGCAGCTCTTGAAGGTACTCCATTTCACCAGTAGCTTGCGGGAACCCAGTGTTTGGCAGCGAGATGAAAAAGCCAACCGCGAAC
CACAACAGTATAGACACGGTCACGGTGAGCAGGAACTGCCACGTTAGCATAAACGTCTCTAGGCACAGCTTCAGGTTCACGACAGCCACAAGATTCGTGA
ACACCACAAATCCTAGAGTAACAAGCCCACCACTTTTCCCCGTCTCGGTAGCTATGACAGGAAAGTCATGAATGCTTACACCGAAGCCCTCAAACGCCCA
GGCAGAAAcaaagaagatgacgacTGAGTGCCACACGCCGTTAAATATCCACGGCCAAAACACGCGACGGGCGAGCAACACGTTCTTCTGTCCGAGAGCA
TACAGATGCGGGAATTTTGCGGCGCTTGTAGAGGATACATCTTGGTCGAACACGGCAAATAGCACCAGTGGCACGCTCGTATAGAGCACGTTAAAACTTT
GAGCAGCAATATCCAAAATAAGCGGTTGACCCGAGAACCCGCAAAAGCACCCAAACCAAAACGTTGTGAGTACGTACGTCACGTTCTTGTAGAGCATGTA
GCTCATGAGTTTGGCCACTCGGCGGTAGGCCCACCGACCATGCACAAAAAGTAGTCGCTGCAGGAAACGGAACTGTGCTAGGCCGTAGTCCGAGGCATTC
ACTGCTTGCGCTCCTTCCTGCCCCGAAATCCCCACACCAATGTGGGCTGACTGGATCATTGCTACGTCATtcgctccatctccaatCGCAAGAGTCACGC
TGTTGGGCTCAAACTCGCGAATAAACTCGACAATATCGGCCTTCTGCTTGGGAGACACGCGGCAACAAATTACCGCCGACGCGCATTGCCGAGTGACTTG
GTAAAACAGGTTACGCAGTTGAGGGCAAAGAGCAAATTCGAGAGCCTGCCCGTCGATTACAAGAGCTAACTTCTGCGATATTGACCGACGGTTCTCACCT
GCATGTAAACTTCCAGTGAGAGAACCATACTCAGGTGATTGAAATGCTTCATCGTCAGCCTCAATCCCGACGTCGTACAGGGACTCTTCATCCGACGTAA
CCTTACCAGCGTATTCTGCATCAGTCGCAACTGATGAATACATTGGAGTTTGGCTGAATGCTgatgaagatcgacgagtTTTGTGGCGCCTTCGCTTGTG
CTTTCGCATTTGCTTTGCTGGTGTACCGAACAGGAAGCCGCTTATTGCAGACTTCGCATTGACCAGGAAATTGTCCGTTTGGATTGACGCTCGGCGCTTA
GCACGACGCCGCGCCCGTCTACCTTCATTGCCTTTTGAAGACATAGTAGAAAGTGATGCCATAAAAGGTGATAGACGAGGAGACGTGCTCGCTGAGTCAA
CATGCTGGGATAATTCCTTTaaagctgcagaagtcgAGGTGTAGTCGTCCCCGCTAATTTGATGCACGTCCATGTCATGGGAAAGCAGAGCACTAGCGTA
TCCAATGTTCACCGCCGTCTCCATTTTGTCGCCTGTCAGTGTCCAAACCTTAATGTTAGTCTCTTGTAGTAGACGCAGCGTCGCAGGTACACCAGCCTGC
AATTTGTCTTGGACAGCTGTGACTCCAAGCAGCACTAGATCACGCTCAATTTCGTTCATCAGTGGGTCAATTGCGTTTGCACGCCCTTGGCGTCGCTTTA
CTAATTCCTCCATTGAAGAGTGCGCCTGCGTATAGCGGGCATTCCAATCCTCGTACTCACGTCGCTCAATGGTTTTATACGCAAGACAAAGTGTGCGCAT
GCCAGCTTTTGCGTACAACGTAAGTTGttccgcagcttcttcgtaAGACATACCACCAGGCGATGCCGTTTTATCGGCTGCGAGTCGCTCGAAAATGACA
TTGTCAGCACCTTTGCAAAGGAGTTCAATCGTTCCATCTGGAGTCTCTACGATCACAGTCATGCGTTTTCGGTCGCTGTCGAATTCGAGCACGTTCAACA
ATTTGTATGTGCTAGGTGCTGCCCAGCCTGGCTCCAAAAGCATCACGGCAGTGGGTGTCCTGTGTACGAACCGTACATtacaaaatgctgctgcagacac
tAGTGCCTGTTCGTCGGGTGACGATGCAGAATACTCTGGGAACGCCGTACTGCACATTTCAGTAAGAGATTTGGTGGGGATCAATGTGTGGCACAGTGCT
AAGTGCCGTAAGAACCGACGCAGAGTATCAGCCTGCTCTCCGCCCACTTGAATGTCAGCGAAGAGCTCTGTCGGGTCAAAGTCAACAAACCTTGGACCAT
CCtttgcagcaacacccgAGGAGAACGGAATTTCATTGGGGGCGTCAGCCTCCATATCTTTTTCTTGCATGGGACCACCGTAATGTTTCCCTCCCACCAT
GCAGTACCGGAAAAGCATGAGGTTCATAGTGAGGGTACCGGTCTTGTCCGTGAAGACGTGATGAACGCGGCCAAGATCTTCATTTAGGGCTGATGATCGC
ACCATGGCAGGCGTATCTGACTCCTTGTCGTACATTTCCAGGTCCTGCTCAATGAAGTAGGCTTGCCAATACTTGACAAACTCCAGCGACACATTTAGCG
AGATGGGGACAAAGTTTTGCATGATAATGAAATACCGCAAGTGCAACTTGGCGAGCTCAGCAAGCGGATGAGACGTTGAAACGCCAGTCAACTTGTGATG
CCTTCGCTCGGTTGCACTAAGAAGGTACCAGAACGAGTCCCCTTCCGTGTGCATCCAATGGGCACCAAGTAGCGCACCGAGAAAGcaaacgagctgctgg
ataCATACGATACCGATGATGAGTCGGTTGAGGCGCCTCTCCACGGACGAGGTCTTCACAACGGGCtctgtgttgctgcaaaACACCTTGGTTTCATGAC
CTGTGAACACCACCATGCCTGTGACGGAGCGCGTATTGCGGAGAACGCAACTTCGCAGCATCATTTGCTTCGCCGTAACCGGCATACGCACGCGGATAGT
ACCATCTCCAGTGGTTTCTGTCTTCAGTAGCCCAGCCGTAGGCTGCACCGGACCTAGCGACTGCGAAGAGAGACCTGACTCATTTCCAGCTACACCCAAT
GCCTGCGCTTGAGCGGGACTTAACACAGCCGAAAAAGTCCCTTCAAAACTGGTGATGCGGTTGTTTGGCCGCTCGCACACCATCATACCACACAAATCGT
TGtgtccaccaccatcaaTAGtgcggctactgctgctggaaccaCGACATAGTACAGCTACCATTGGAATAGCTGTACGAATTTTGAGATTGGTCTCCCC
GTCCAACGACTTCGTCTCAATATATGCGAGATTGGATTCCTCACTCGGCTGCTTTGACGACGGTGGCCGTTGGGGTGCAGGATCATTTCCGGCCTCAGTC
TGAAGCTGCGACGTTTCTGCTGCAAGATGGATCTTCCCTTCTTCCAAATCATCAAAACCCTGCAGTTCTCTCGGGCTCGCAATTGTTAGTTCTTGAGTCT
GTGgttgttctccttcatcatcatGTTCCACCGCCTCTGCCGACAATAAGAACAAATCTGCAGGGATCGTCTGATCATTCATCACCTTGACAATATCTCC
CACACGCAAATCTCCCCATTGTCGCTGTTCCCAATCGCCCAACGGGGTGAGTGTCAACACTGGTCGACTATTCGCCACCTTGTCAGCTCGATGTCGCTCT
CGGTCTTCCAGCGCCTCTTTAATTGCACTACATACAAACACCACCGCTAGCGGCAGCAGAATCGTCGGGATGCCACTCGTGTTGCTCACCTCTCGGATGG
TCTGGAGCACCGCAATAAACAGGAAATAAACATTCGAAGGTCGCTGCAATTGCGCCAACAGCACGCGCGGCACGAAGTTCCAGGCGCTGTACTTGGCGCT
CACCACCACGTTGCTGGCGAAGGGCGACGGCGGTTCCACGGCGTCTTCGTGTGGCCTCTTGACGCCTCCAAACATCCACGACGACCGCCGGTGGCTGCCC
AGACGACGCGCCTCGCGCTCCtcacgtcggcggcggcgctgcgccGCGTTCGCGCGCGCCAAGAGCGACTTGCGGTCCACGCGGATGacgcgcagacgct
gggCCGGGTCCTCTGAAGCAGCGCGAGGCCCCGCCGCGGCCTCGGCCTGGATCCGCATATTGCCAGCGAATTGCG