Description :
From Genome Similarity Track
Location :
Scaffold_87:130394- 138843
Transcript NameFunction/comments
Hyaar_Emoy2808766hypothetical protein

Sequence
8449 bases(100 bases per row)
TACAATTGCGACGGATCCAAAGCTGGACTTCTTCGTAAATGTTGGTGATAAGGATGGGATGCTTAGAAAGAGATGCTCGACATCAGTTGAAGCGAGGTCG
TGGTTCGAGCATTTTTTGTATGTTTTGAGCGGTATTGGCGGTGCGAAACCTCACCAGTTACTCTACTACGAGATGCTGTCACATTCCGATGTTGGTCCGT
TAGATGTGTTAGCCTTTCTGTGGAGAAGTCAGCGATTGGTGCGGTGGGGAGAGAGGCCCAGACTGTCTATTATAGCTACTTATCACTAATAAGATGTCTG
GTTGTGTGGTAACCACCTCTTTTATGACAGAGTTTACTACTCCTAGCTCCCAAAAGGGCCCGTGGAAACCGTCCATTGACCAAGTCCGGGGTTAGATTCT
TGTGTGCACTCTACGGATGGCAGGGCTGCTCTCGCGCTTGGAGCAATTTGATTCAGGGTACAGAGGACGCTTGACTAGGAGTCCTGTTATCACTGCGGTA
GTCCCGGCGAGCCATCTTGACTTAATCCCTGGCCATCACCTCGTAGTAGACTTCTTGCTCTTCAGGTCGGCTCGGGCTCACAACGTGCTCAAATGTGCCC
AGACGCACCACTGGACGAAGTGTATCTGGATCGATGCTAATGTACATCAACAACTGGTACTGGATCTCAACTGGGGTCGTCACAGTCTTGGAGGAGTTCT
CTTCGTGGGACCGGGCTCATGCTCAGCGAACGTGTCGGCGAGTTGTGGGCAGACCGCGAAGAGTAGGAACTTCTTCGTTTTGCAGGGTGATTCGATCCAT
CGTCGACGTGCCCTGCACTAGGATATCCTGCGGACCGCTTCTCTCTCGAGCCGCACACTACGCTGCCTCCCATAGCGCACGCAGCGAGCACAAACCCTCC
CCCCTTTTTACCTTGGCCCCACTATGGAGGGCTTCCCGCCCAAGGCAAGGGGGCCAGTTTCCTGGCTCCCCGGAGGGTATCGTCTCTGTCCATTATTGCA
GCTGGTTGCCGATTGGGAAGTGTTGCAATAGAAAGATCTGTGTGCCACTCATGCATCATTGGCATCTGTACACTTGATGTCTACAAGCTAGTTGGTCCAT
TTACATGACCGGATGATATTCTCGGATGACTAAGGTCACTTTGTGATAGAAATCTAGCTACCTCTTTTGCTACATCATGCTCGTCTCTAAACAATTTGGC
TCAATAAAGCTCCTCATCTATTGTAGAATGGACAGCAGCTCCTCTTCTATTGTACAATGGGCAGCAGCCATGCAGTTCTTGCAGTAATAGCCAGTCATCT
AGCCAGCTCCGAAGGGTTCTTCCCTCCCAAATAAATCAGGTTGCGTGTCTCCTTGTGCTAGGGGAGACTTTAAATACACTAACATTTTGGGTAGCTCTAA
ATACACCAACATTTATTGCTAAATCCACCTACATGATTTATAGGCTATCCATTTAACTTAAGGTATAGTAATTAATGCTGAGAGAACATACACTATTGAA
CAAGAGAACGTCCACTATTCAGCCACGGACAGGTCTTCCTTTTAATCTTCATAACTTGAACGTCTACATGACGATGAGCCATCACATATACACATCTGGT
GGTGCAGCTCACGAGGTTATACCTTCAGTTGCTCCTGTCTTGGTCTCCACCGCTAGTCGTGATGCTGTCATTAATGACGCTGGAAACACTGATGAAGACA
CTACTGCTACTGCTGAACCTTTAATTTCCCCTCTATTATGCAGTTGCGAAGATCCCCTCCCAGTCGGACCATTCCGAAGTCAAGAGCAAGCTGTGCTGAC
CGTCAAGCAGTTCGCCGTGAGCCAAGGTTTTGCTGTCAGCATTTCCCGCACAAGATCGCGCGGCATCAAGCGCGTTCACCTCAGTTGCTTGCAAGGAAAA
GAGTATCGTGGATTTCATAAACGGCTGATGTCCTTGCGAGACCATGGAACGAAAAAGGTTGGCTGTTCGTATGAGCTCGCTATCACCTTTGATAAGAATC
TGCCCGAAGATAGAGCATGGTCGACGATATGTTTGAATAACTGTCACGCTGGCCATTCCCGATGTATTACCAAGACAATGGTGTCGGCACTACCAGCGGC
GAGGCGCGTGTCAAGGGAAGAAGAAAATATGGAATCCATGGTCGTCCAGATGCATCAGTCTGTAGCTGCTCCACGGGTATGTGTGCTTATGTGATAATCT
AAACATTCAATTAAACGTGGGTTGTATCTATTTGTGATTTTGTATAGGTTATACTGAACCACTTGAAGGAGACAAGTGTCATTCTAAAAGCAAGCGATGT
TCACAACATCGTCCAGAAAGCGAATTTAAAGGCTTTGTGTGGTAAAACGCGTACGGAGGCTTTGATGCTCCACTTAAAGGATAAACTTGTCACGGCTACA
GTTGCAGTGGACCAAGACAACCATGTCCGGTATCTCTTTTGGCAACCTGACCTGTCCAAGGACTTTACCTGCCGTTATCACGACGTCCTCGTGATTGATT
GCACGTACAAGACAAACGCCTATAACCTCCCCCTCCTGCACATTGTAGGCTTTACATGTACTGACCAAACGTTTTTAGCTGCATTTGAATTTATGGATGG
TGAAGCTTCTGATGACTATGTCTGGATGATAAGCGAGGTTGACGGAATTCTCCCGCGACACCCGAAGGTTCTCGTTGTAGATTGCGATCGCGGACTTATC
AAGGCTATTTCGGAAAAATGGCCAGGCGCAGCAATCATCATTTGCCGATTTCACATTGCAAATAACATAATTACCCACTGCCGAAGGAATTTTACAAACT
CCAGCGAGAAAACTTGGAAATTGTTCATGAATCACTGGAAGAATATTGTCCATGCGCCTACAGAATCTGAGTTTATGAAGCCCTGGAAGCAGCTCTCTAC
AATTACGGTATGTTTTATTTTCAGCACTCGCATTGCAATTAATGTAACATTTATTTATTACTTTACCAGGATTACAAAACTATCGAGCATCTTAATACGA
ATAAGTTTCCTCTTCGCAGTCATTGGGCTTCGTACTGCATCGATCAGTATCAGCACTTCGGACATACTGTGGCCTCGCGTGCTGAAGGGGCACATGACAA
AACATAAAGAGATGGCTTAATAGCGCAAGCGGTACCCTCCTGGACGTGTACGAACGAATTTCGCGAGGCGTGGAATATGAAATTTTCAAGGTTACATCGC
AAGATCTCACGCCACGCTCTTGTGCTACTGAAGAATCAGTACCTTCTCGCCCTCGACCGTGCAAACCTCAGAGAATGCACCGGATATTACATGAGGGTCC
TTGGAATTTCCTGTGCACACATCATTTGCTGTCACAATGACACAAAAAAGCACATTGAAGTTAAATGATTTGCCAAGCGATGGGAATTGGACACCGTTAA
CAACCTCGATCGTGAAGTCTTCGGAAATTTTTGCCACCCCTTCGCCTTCAAAAGACGCAAGGTCGCAATCGGGTGCACCAAAAAACGACCAAGCGTCTAT
TTTCAGGCTTCGAACACGTGGAGAGGCAACTTGGTGTCAGGAAGTGTAGCCACTGCCATGAATCCGGCCACGACAGACGCCGGTGTCCCTCGCGTGTCTT
AGTCGTGCCTGACGTCACATTGAAGCGCCCGTCGAAGTCGGCTTACCCGCAAGTCTACCGTCCATCCAGTTCTCTCTATCTGCGATGCCGGAGCCATTGC
ATGCTCAACGCTTAATCGCGCCGATGCACCTGACTCAACCTGTGCAACATACGATAATTCCGCGTCAATCCATTCCAGCTCAAGGTACACAGTCACGCAT
TGATGTTACGACTCCACCTGTGCTGCACACGACGATTTTAAGTCCATCCGCTCCAGTCCAAGCTCCACCGCCACGTATCAGCTTAATCTTGCTTTGTCGC
CGTTGGACAATACTTCGAAATAGACACCGTAGCACAATAGAAGGTCGTGATTTTGCTAAGTGCGATAGATTTGAATGATAAAACTGCATCGGATATTCAG
TATAGTGGACGTTCTCTTGTTCAATAGTGTATGTTCTCTCAGCATTAATTACTATACTTTATTTAGGTTAAATGGATAGCCTACAAATCATGTAGGTGTA
TTTAGCAATAAATGTTGGTGTATTTAGAGTTACCCTAACATTTTTGCCTGAATACACTAATATTTTCGGCTTTTTTTGCGTTGCCCATCCCAAACTGTGC
CGACTATCCATTAGGCCTAATTATTGTATTGACAACAGGGGTTAATCGACGGGCCACTTTTGCGAGCCCCAGTGATAGTGGCCGCGATTGGAATCGACAT
CAACACGTTCACCCCGCCACCACTCTTTTATCCATCAGCGTAGTGATAGCGCTTAAGGTCGACTGTGTTCACGGCCATGAGTTCAGCTTTGTAAAACATT
GCTTTCTCAGCACTGTGATAAAAATACACTGAGTACTACGGCTTACAGCACATTCAAACAGGTACACGCCCCAAATAAAAGTGGATAGCATTTTTATCCA
AAAGGATGAAAGCTAATCGCATATCCTAGCCCCTCTCTTGGCAAGAATTCCATGCAAACAACCAGAAAGTGACATTACTTGCTCATATTTAGCTAGAAAG
CGTCAAGCTTGCATATTCGTGCGTCCCCGTGAAGTAGCTTCAGCCAAATGCACCTAGACAACCTTCGCATCGATATCGCTCTTTCCGCGTTGTACACTGC
TCCACCGGTAGCATAGTCGCGTTATAACATTAGGATGGTGGCCATTACCGCCTTTGTTAAACGAAAAACTCGACTTACACTTTCGTTGGGCGCGTGAATT
TGAAGGCCGACCCGGCGACCAAAAAAACCACAATCTTTGCAGTGTTACAGTCTTGCAAGGTCATGCATGGGCTGGTCGTGATATTGCCTGTATCTAGAAT
GTTGAAAGTGATATTCCGTACCTAGCCGGGTACTAGTTGTACGCCGGTGAAGTCTGCTAGATAGTGCTAGATTAGTCCGTATAAGAGGTAGTTCTAGAAT
CTTCGATGCGTAGGGAAACGTGTGGCAGCGGCAGAGGCCGCTGTACTGAGGGATCTCACTTTGTATTCGGTAAGCCACTGAGGGGGCCCGCGGCGGCGGG
CCGGAACGTGTCTTGCACGCGTCCGTAGATATATTCTTTTCTATTATGTGTTCTTGGTTTTCTACATAGAAGCCCCGTATTTCTCTTGGTACATAAGAGA
GAAATGCGCATAGTCCCACACAAATTGCTGCATAGGATGTGAACGGCGAAGTCTTGGCTAATGGCTTACTTCTTGGTGGTGTCAACGGCTTCCTTCTGAC
TACTAAGGGCCGCGATAGTATTCTTCATCTCAGCTTTACGGCGTAACAGCATGAATAGCATCATTAACAACAGTAGAATCCGCCATGCTAGAATAGGAAG
GTGGAAGGGTTTAACATCATAGCGAGAATGAGAGGGGTTGTGGAAAAAGGAACGGTCAAAAACCATGGCTCGTCGCTTAACCCATGTTGGTAATACAATA
ATTAGGCCTAATGGATAGCCGGTACAGTGTAGGATGGTCAAAGAATAAAAAGCTGAAAATGATAGTGTATTCAGGAAAAAATGTTAGTGTATTTAAAGTC
TCCCTGTTGGTAGCCATGCATCGGGTATTGGTGAAACGACCACCGCCAGTCGAAGATTCTGCACCCTACAGTATTAATGTCGCTTTATGTGCACCACCAG
TTGCTCCGACCCCCCCTTATCCTCACCAATACTCTGCGATTACTTGTCTTTCTGGTGGCCAAGTGCTTCCTTCTCCACGTGCTTACACTCGCCATGCTGG
CTGGCGATAACGCTCTGCTGGCTCGTGCAGCCGGCCCGATGTCTCAAGTAACTTCCTCGGACGAACATCCAGCGAATGAGTCGAGCTTAGAGGACAAGCA
AGTGCCTCAGTCACACGGCTACACGAAAGCCATCGCCAGTAAAGAACGAGGACCGGCAAAGGTTTCCCCATTGACTGGGGACCGCTTCGTGAGGAGGCCA
AACGATGGTTGGATTGCAGTGGTGAAGAATGCGGCTGCCAAGATGAAGCCTACCAAGATGAAGTATTATGCTGCTGCGCTAAAGCTAGAGAGGACGATCG
CAAAGTTTAAAGACATTCAACAGCGCAAAACTTTCTTGGAAGACTACAGGAATGAGCTCCGACTGGACCCGGCGGCCATGAATTCATACAGAAGCTTCAT
AACCAGTGCTGAAGACCTTCGACGTAGAGGACACAAGTACAGATTATACTTGGACTATAAATTATTTATCGGTCGTGGGATGGAGGAGATGCAAGTTAGG
CTCCGCAATATGCATGCACCAGAGCCCACCCGTTAATCTAGGTAAAGTATATGTTCTCCATTCAACACGCACAAGAGGACACAACCCTCTCTTTGGCTCA
TTTCCAGCTGCTTCACTGAGTTCAACCTATAATTGAATTTTAGCAACATCTTTGCTCACCTTTGTCCTTCCATTTATAAGACTGTTACTAATTTTAAGGG
GATCACCCGATCGCCGCTACCTTGTTATCCCGACGCCAGGTGTTTTACCCAATAAGGCAAAACAAAATTACCCAAAATTAGGTCAAATTGAGAATAACTT
GGTCGTTGCTACCCCAAAACGACATGTATTCGACAAAATCGGTTTTACATGTATGCATCGTTTTATTGTTTCATATTTACGCTTCTTGAGTGTCTCCAAA
ATAGAATGCGCAACCGATGAAGCCGAAATGGTGCGTGATAAATGAGAATACATTCCATTGCTTCCGACGTCTGCATCCAGCCAGATGGACACAGCAATCA
AGAGTGTGAAATATGTGTGAAAGAACTCGAACGCAGGGCGACAGAGAAGCAGCAGATACGTTATAAAATTCTCGAGGTGCTGCTGAAACGAAAGGCCGCT
TAATTAGTCTAGTATATTCCACCTCGTGAGTATTGTATACGAACTCACGAAAGGATGGGGCTCCTGAAGAGAAGAAACGTTCCTTCTACATTATCTCGAC
CAGATATTTCTCCTTACTACGGAAAGCAAGTTCTATATCCATGTATCGATTGTTTATTTTTAACGCTGGTAGCTCCTTATATCTACAGAGGCTGGCAGAT
TGTCTGAATAAAAGGTTGCTGCAATCTGCACGTATGATAACGTGGCTCTGTTTTTCAAATAATAACCCCAATCTCGACGAAGACAGTCGTGACTCTTTCG
GTCATAGCGACGTTAAGGTGACTCGGCGACAATGTTACTGGAATTTAATATGGTTGTGCGTTCAGTATAACTAGGACAATTAAGATTATACACAAGAACT
CATCCGTACAACAGCTACCGATGCACGTTATCAAAAGCTCGCATTGGCTTGCATTGTCGATTGGGTTTTTATGTAAATCTCGAAACATTCGCAGCACACC
AATACCTGCTCACATACTCGATCGATTTTTGGTGAAATGTTTCCGATAAAATGACAGTTGCAAAGATAAGGCAGTTGGATGTGTCGTTACGTTGGACACA
ACACTTGAAACTGTGTCTTTGGACCGCACAACGCTATCCATTATATGTGAAGAAGACGACGAACGTATAGAAAATGAAACGATTCCATGTATTGGAAGGA
TATGTAGTCGCGGATTGTGCGATTAAAGAAACTAAACGAGAAGATAAAAACGTTAAAACACATATTGTCACAGACGTGTCTGTTTGGAGTTGCGGCGACT
AAGTTATTCCCATATCTAAAGATACTCTCAGCATTACCTGTGTGTTATTAGGTATGGATGGCGACAAACTAAGCTATTTAACTCACTGCGTATGCTAAGT
AGGGTCGAGAACACGATAGTCGAATGTGTTATCAATTATAGTTTTGTCGTCTTCATCTACCAGGTTTTCTTTTTCTTCGGAGGGGCCCGTATACAGATGC
TTGTTCAAGGTTAGATCTCTCCATTGTACCACGCTGGTATTACTTTTGGCTAACCACAAAATCTTCTTGGCTCGCTTGAACTTCTACACCAAGGTAAACC
GGTAGCTCCCCTTTATCGCTGATACCATGCAATACAATTTTTCAAAAAGATAACCTTTGCTGATTAATTATAGGTTGTGCACGAAATATCGTCGACATAG
ACCAGTACCAGTACCATGGTTCCTTTCGAGTCATGGATATAGTATAGACATGATTTTGTTGAGCAAATTTGATACACATTCGATTTTCACTTTTAGAAAT
GATCATCCCGCTCACATCCATCCTGGAGTAGACCATATGAAGCCTTGCGCATCATATACATGAGCTCCTTGGGCCGACGTGAAAAACATCAAATTCTTTT
GCATACTATGAAATCGTCACAACATCATTGATGCACGCATTGTTCTAAAGCGCGACTATGATCGACAGGAACATCTCTACAGCCGATAGCTGAGTCGTAA
AGCTTAACATACGCCCACGGAAGAGGGAGTCCCAGAAAATTCAATAACA