Description :
From Genome Similarity Track
Location :
Scaffold_39:130391- 133061
Transcript NameFunction/comments
Physo_135552predicted protein
Physo_135553hypothetical protein

Sequence
2670 bases(100 bases per row)
TGCGTGCACGTGGCGGAGCGGCACGGCCGCCTGGTCGCTGGTCAGGATGGCCTGGATGTCCGGCAGGTTGCTGGTGGCCGCGCGCGCGCTGTCGGCCGCG
AGCGCGTCGGCGCCAACGCCGCCGGCCTCGGCGCTCTGGCTGGCCACCAGCAGCTGCGCCAGCATCTCCTTGGCCGCGCTCTCCAGCAGCGGGAGCTGCT
CCTTGGGGTTCTTGAGCAGCAGGTCCTGCAGCTCCTGGTCGAAGGCCGCCACGTGCGAGAGGTTCACCGTCACGAACCAGTGGTTGCGCCGCGCGTTGGC
CAGGAGCTGCTCGCGGTAGAAGAAGAGCGGGCCCACGCGGAAGCCGCGCAGGAAGGCCAGCAGACGCCGCTGCAGCGCCGCGGGGCTCGCGCTCTGGCGC
GCGTCCGACGCCTGCGCGCTCTCCATGCCCACGGCCGACACGCGACCCGCATCCCAGTCCATTGTTGCTACAGGAAGAGTTCAATTATGGCCGCAATGCA
GCAAAAAGCGCGGGAACGACTGGATACTTAATCGAGGAAAAACGGTAGCATAGTTGTGTAACGTACGTAGTTATAATCGAGGATTGTGATTGGAGGGAGC
AAGTTGAAGTGTGTTGGCCAAAAGTAGCCATCCCCCATTGAGGCCAAGGCTCTTATCAGATGCGACCACAGAGTCTTACCGCAAGAGTTAACCAGCCAAG
CAATGATACTCTGTTCTCTCACTTGTTCTCTTTTTGTCTCGACGTTACTGCAACTGTAACTGCGATGAAGGCTCGGTTCACTGTGAACCCGTTCGAGGAG
CTCAACCTGACGGAGCTTGACCAGACCAGCCTCAAGGACCTGGCCAACCAAGTCATCATGACCACCAGATGTGCATGAAGTACATGGACGCCAAGCTCCA
GGTGGATCTCACGCACTGGAAACCTCTCAAGGACAAGGACAGCCTCAAGGTGTACTCGGAGAGGCCCGAAGCTGTAGCTGCTGCAGTAGCTGCGGGTGAC
GAGCCGACCGGGGCAGGACTGCTCATGATTCTGTGCGTTGGCACCAAGCCGGGGAAGCTGGACGACCTCATGTACGGCGTGACCAACGAAGACCTCGAGA
CGATGCGACTCAAGGCCTCCTACGTGAACGACTTCAGTGGTGCAGCCGTGCTCGAGTTCGTCGTCTTGCCCTCGCTTGAAGACCCGTTCCAGTCGCTCGT
CGTCAAGTGGATGGAGCTCGATATCCCCTTCAGCTCGACTAGCCTGGTCAAGAACCGTGACTATGTCTACCTGGAAGGCACAGGCTTCGTTACGAATGCA
AGGGGAGAGCGACTGGGCTACCACGTGCTGCACTCGGTGAGCTTCCCGCAGACCCACAGTCTACCGAACCGCGTGCGTGGCAACATTTCCCTCATCGGAT
TTTGGCGCCAGACGGGCAAGAACACAATGGAGCTGTATGCCACAGGCATCATGGATCCGGTAAATGACGGTCTAGTCCGCAAGCTCGTGGTGCCGAACAT
GGCGACGTTGTTCCTCTCCAGCCTGAGGTATGCCCACTGCGGACGGATGCGCAAGCTGGCATTCATGCTGGAACAGCGCTACCAGGAGTCGAAGACTCAG
GGGACTCCGAACAAGGAGAGCGTATGCGTGACATGTTCCTCTCAGATCACTGGGCGTCGTCTCGGGGACTTTGGCAAAAGCAACAGCACGTGCAAACTGT
GCTTCGGCTTCGTGTGCAGCAACTGCAAGATTGTCCAAAAGCTGAGCTTTGTGGACGCAGACCTGCTACTATCACAGCGCAAGGTGACGTTCTGCTCGAA
GTGCATCAGCGAGGTGCTGGGCATGAGCGCTGTTGATGTTGCCCGCGCTTCTCTGTTGGGCAAGAAGAAACACCAGCACACCAGTTCTAGTATTGAGACG
GCTCTGACCTCAGGTGGTAACAGTTCCGACTTCTCTTACGCCAGCAATTAAGCATTGAGTTGTATCTAGATAGTATGGAAGTGTGAAAGGCAGATTAACC
CGTAGATATTAGTAGAATGAGAAGGCAAGTGTATATTTGTGGTTGTTTCCACAAAGCTGGAGCATCTTGTGCTCGATGGGATGTGGATTGAGCTTCACAT
TGTATAAAAGTTGGAACTGCGGCAGTAGTCCAACAAACTCTATTGCCATGTCAACTCAATATGAATGCAAGCAACCATTTGCAGCCTACACTAGCATAAT
AACATTGACGCACATCGTCCTTCGAGTTTATTGTCGATGCAAGTCGCATTCGATGCAATGTAGCCTCAAAGGTCGCGTACGCTGCATGGACTGCAGGCAG
ATAGGCTTAGTTGCGCAACCGCGCCAATACTCAATAATCGCTCTATACACCCCGCCATCGTCTGCCTCAAACATGCGTTGCTTTTCGGTATCTTGCGCGC
GTTGCGGCCAATACCAACAGTCAGCTCCCACTTGACATGGAACTGCACAGCAACCAAACTCACTCAGGTGGGCAATTGTGCCGCTCTCACAGGGTATTGA
GGCTACTTGGCTGGTGATGCGCAACTCCTCGAGTGAGGGTTTCCGGTGGCCTTCGCACAGTGCAATAGTTGGAGCCGCAAGCTACAAAACTCCCATGGGT
GCAAGAGCTCTTTCACAACCCATAACACCGCCATTACAACAAATGCAAAACACGCACCACCACGGCGCTA