Description :
From Genome Similarity Track
Location :
Scaffold_438:13038- 14140
Sequence
1102 bases(100 bases per row)
CAGTATGGAGGTCAAGGTGTGTCAGTAGCCAGACAGTATTACCTCGCACGGAAGCGATCCGATGAAACCCCGCTGGGGTACTTGCATCGTCTTAATGTCG
CGGCCACGCATGCCAAGAACGCGATTAAAGAAGAAAGACTGGCTACATCGGCCACAAGTCGCGAGCATGTGGAACACTTCATTGCTACGATGGACGATCG
CGATCTGGCAAAACAGCTGACCTTACTGCTATTGATGGATATTGATGAGATGGAAGAAACTCTCCGTGCGTGTCAACGGATGGAGAATCGTCAGATGAAA
TTGTCGATGGGATCAAACAAATTCCATCAGCGATCGGTCGCACCTGCAAATCCGATGGCGTCCAAGACAACTCGGGCGGTGCGAGCGATCCGCGAGAAAG
TCGAGAGCAGCGGATCGGAATCGGAGTCGATTGGATCCGAGGAAGAACTGGATCGTCGTCGTGTTTGTGTAACAACTACACCCGACCAAGAAAAACCGAA
CAAGGATCATCGCACCTGGCAGAAAAACACTGGTGAAGGGGAGGGACGCGATCGTAGTGGACGATCGAAGGCGTGCACCCATTGTGGATCTACCAGACAC
GATGATCGAGGGTGCTGAAAGAGATTGACGTGCCAGAAATGTGGTCGCAAAGGAAACCCCTCTGACAAATGTTTCTTCGTTTGTGCAGCCTGCGGGGATA
TACACGAGAGTGGCAAGTGTTCCATGGAAGAATTTTTCAATTTGGTCCGAAAGTGGTACGTGTCTACGAAGCATGCTGGAATGTTTCCGCCCAAGGTGGA
GGAGATGTTAAACTAGAACGCTCGCCAGGTTGGAATATGGCACGAGCCGAGCGTTCTAGGCTTTGCCTTTTTATGCATTTGTAGAAGGACCACGGAGAGA
TCAAGAGGTTAACGATCGGATCGATCCGATCGCTAACATACATAAAGATCTTACACTGGTCTCGTCAATATCAAGTGTGAAAAGAGTGGATGATTACGCC
CGATCTCCTGTGAGCATGGAGCTCGACCTCGCGCCAGGGGAATCGTGCGGGTATTGGAAATACCACACACCTGGAAAATGGTTTAAGCAAGCAAAAGCGG
TG