Description :
From Genome Similarity Track
Location :
contig_19:130350- 133368
Sequence
3018 bases(100 bases per row)
GCTGCACGTTGTCCTGGCAAAAGTAACTTTTTCCGCAATTCACTCCCGATTTCGCATTGGCGCTGCAGGCATCGCGCTCGGAGACCAACACCAATGAATC
AACATGCAAATTCGGGTGACTCAGCTTCGCGCGCACCACCTTGCAACAAAAAGATGACAAACCGCAGAACTGTGGACCTGGCCATCAAAAGCTTTACAAG
AAGCGAAAGTGCACCCCAGGTTTGTCAATAAGACAAAGCCTCCAATGATACCAGGATTCAATAGCTTCTTAGTTAAACATACACAGAGGACCCAGTTAGA
CTTTGTGGCTCGTCGTCGAAGCCAGAAAATAGAAATCACCGCGCTGGTCTGCAGTGCAGCATCGATGTTTTGGTGGCACCGAAGCAGCAAGCCAACGACG
GCAACTTTGGTCCGAAATTTTAGCGGCCTCGATCGCACCGGGCTCCTTCCTTCCGGGGGTAGCTGGCACGTGCGGTGTAGCGCATCTTCAGAGTGTTACG
CTGGGGATGTTCGCGCTCGGTTCCTTCTCGATTCCTTTTTGACGGCTCACTCGTCACGCGTTCGACGCTGAGCGATGATTCCTTTGGCCCGTGCAGACCC
CTGATGCCGCCGCCCGCTGTCCACAACCATAGCGAAGCCCCACGGTAACGCAGCCAAAGCCGGCAGCCGAGGACATTCCTGCAATCGTCGCTGGCATCGT
TTACGGCAATGCCAATTTGGCATGGAGAGAAGCGACCGCGCACTGTCAACAACCACAATGACGACCCAAGTGTGGAGGGAGCCAGGGAGAGCTGTTTTGC
CAAGGTATAACCGTACAGGTATGTAGTATAGCGACTCGGGGTCTTGCTTGAGCGGTTGTTGTTGACATCTAACAATGGTGCCTCAACCCAGCAAACGCCC
CCACTTTGTACTGTAGGTCAAAGACGATTGCAACCTGTACTGGACGTTCGTTTGCGTAACATCACCAGCGATGGTATGTTTGGCACGCTGATCTCTCAGA
GGCAAGCACATTCTCTCGTTTCTCATCAGAGGCAACAGTTTCGCCTAGATCACTCGTTGGCGTACTTACCTGCTACTGCTTTATTCTCACGTAGTCGTTG
TCACAGGCCCAAGTCGTTTCCAGCACCCTCAGTGTCTGATGAACTAGATACCCACGGGTCGTCCACACTGTACTGACCACAAAAGTTTCATCCCAGACCG
TGAACGAAAACAACTGTACCATTGGCGAGGTACGGTACGGTTGCTAGCCTCAACAAACAACAGCAGCGTGTCTCGAAGCAAGTGCTTCCCGGCACGGATA
CCCGTCGCATGCACGGTCGTCTGCACGGTTCACAGCCAGCTCACTGTGATTGCCTGGACTCGAGTTTCGAGCCAGCTGCTCACCTCGTGGTTACCTGGAG
CATGGAGGATTTCTCTCTCCTCCACGCGAAGAAAGAGCCCTGGCGATCACCCCTGATCTTAGCAATGGGCTACACGAAGTGGTGGTTTCTGTGGCTTCTT
CTGTGGCTTCTGCTCAGGTTCTTCCAGTCTGCTCCGTTCTAACGCATTCATGGCCATGGACAGATAACGGCGAATGATCTCGCCTTGAACAGATAACGAC
GGATGATATGTATCCTTGAGCAAATTCGGCTTTCCGATCAGTAGTGATTTGTTATACCTTTTCCATTGTGTGGAAATAGTAGTATGTGGCTGCGCTCAGC
ACTTACTTATCCGTTAGCTTGATTTGCGGACGCTAAGTCCTCCGAGCCGGGAGCCCGTGCTGCCGAATCCCAATGCAGGCAAGCCCTCGCTGCTCTGTTT
CGGATGTTCTATTGATTCTATTGACAAGGCCAGCCAGCGAGACCTGGCACTCAAAGAGCAATGGAAAGGCCTTGTGTCGACTTTGCCGAAATCGACGGAG
GGTCTTGTTTGTGAGGTGTCGGAACTTGCTTGTGGACGGTTCTGGAGGTTGTAGTTGTTGTAGTTGATGCGCGGTGTTGAGGGCAAAATGCAGAATGGTT
ATATTTTTTGTTTTGTTTTCGTGCCCTGTTGTTTCTTGCTTTCCTAGGGCTCCGCTCTAGGAACGACACCTTTCAATACATACACTAAGTCTTGGTTGTC
TTCTTCAACCTCTTGATTATGGTCGTGGCGATGCTCGCCGTTGGCTTGAACGCTGGGTTCGCGTGGGTTGCAGATTTGCAACATGAAGCGCTTTGCTGGC
AACCTGATAGTCTGTTGCACGAGCATGGGCTGCGAAAGCTTTCCTGTTGACGCCACCACCATCAACGAGTGTGTCATGGGTTGTTGCCGGTGCGACTCGA
CTTGATTGTCCGCGAGTCCGAGCGCTAGCGTGGCTTGCGTTGCGCGCAGCCAAAGGCTGACAATCTCCCCTAGAAGAATTGCTCTTACTGCGTTGCTGCT
CCCGCAGCCCCTTCAGTAATTGATGCCAATGAACGACATGTTTGATGTCCTTCTCTAATTCCCATGTACACTCTGACATCGGCTCACCAAGCCACTTGAC
GAGATACTCTGGCTTTCGGTTAAACTGCCTTTTGGCAATGAGCCGCTCCACAATACGCATACCGTCGTCGACAAGTTCATCGGGCAGTTCTACTGGGGTG
TCCTTGAATTTTGGGCGCGAGCGGAACCGTTCGAACTGCTCTGGGTACGGCGAAAGGAGGTCGACATTGAAGGAAGGATGAATGCGTCGAAATCGCTTTG
GTAATTTGAGCCTAGCCACGTTTTCATTCACCATGTACTCGATGGCAAAAGGTCCCACCAATCGTGCTGCCAACTTTGCTTTAGTTAGCTCCGTGTTCTG
AGAAACATGCTTGAACGATAGATGCTCGGTTTTCAGCAGTACCTGATCACCAGCTTTGAAGTCTGGTTCCGACCGACGCTTGTCGTAATACTGCTTCTGT
TTTGTTTGGCGTCAAGAAGAGCTTGCTGTGCGCGTTCAACAATCACACGTCGGCGCTCAGCAAACTGCCGAGCAAATTCTGCCTTGGTACGTACTTGGCG
AACAGTATCATCAGAATT