Description :
From Genome Similarity Track
Location :
Scaffold_618:13031- 14470
Transcript NameFunction/comments
Phyin_T30-4PITG_21854cAMP protein kinase

Sequence
1439 bases(100 bases per row)
ATTCTGACCGTCGCCCTCACTGCCGACACCTCTGCGCACGCGCCCATAGCCCAAAAAAGACGCGAGTGACAAGGTCGCTGGAGTTTCGCCACACGCGCAG
ACTCCTCCGCGATTGACACATTCGACTACCGCTGAACACGGCAGCCGTCAACTGAGACCACACTAGGGACACACTCAGCACAAATGGCCACCCCAGACGG
CGTTAAGGTCTCGAACAAGTTTGCCGCCCCGCTCGATGGCTCGCAATTCGACATGGGTGTGACGCTAGGTACCGGCTCCTTCGGTCGTGTGCGCTTCGCT
ACCCATAAAGTAAGTCATGTCGACAAAGGTAAATAGGCGGGTCCATTCGAATAGACTGACGGTGTCATGGCTTCTTTGGTAGGCAACCAACACGTACTGG
GCTATCAAGATCTTGAAAAAGGCAGAGATCATTCGGCTGCAACAGGTCGAGCACATGCTCTCGGAGAAGTCCATCTTGCTATGTTTGGACCATCCATTCA
TTGTCAACTTGGCAGGCACGTTTCAGGACACCAAGTACCTGTACATGGTGCTCGAGTATGTCATCGGTGGCGAGTTCTTCACGCACCTTCGAAAGGCTGG
GCGGTTCGACAACAACACGGCAAAGTTTTACGCAGCACAGGTGGTATCCATCTTCGAGTACATGCATAGTCAGGATTTCATCTACCGCGACTTGAAGCCC
GAGAACTTGCTACTAGACAACGAGGGCTACATCAAGATCACTGACTTCGGGTTCGCCAAGCGAGTGGCGTTCAAGACGTACACGCTTTGTGGCACACCCG
AGTACATCGCGCCGGAGGTGCTACTTAACAAGGGACACGGCAAGGGAGTAGACTGGTGGACACTGGGCATTTTGCTGTACGAAATGCTGGCAGGACAGCC
ACCTTTCTGCGACGACGACCCCATGGGCATTTACCAGCAAATTCTTTCAGGAAAGCTCAACTTCCCGCGTTTCTTCGACCGAAACGCCAAGGGACTTATC
AAACGCATGCTCACAGCCGACCTTACGAAACGGGTACGGTTGTCTCAAGAACGGAGTGGAGGACATCAAGAAACACAAGTTCTCTCACCGGTATCAATTG
GGAGGACCTGCTCGCGCGCAAGGGCGCCGCACCGATTATCCCACGTGTCGGCACGGCCAACGATACGTCCAATTTCGACCCATACCCGGACTCCATGGAG
GATGCGATTGTCCCCGTTTACAACGGCAAAGATCCCTTTGCCGAGTTTTAGACGATACACAACGATGGAAATGGTACGGACGCTGGTGATACCAGCGGTA
ACAAGTGGTGTGAGCTTCATGCAAAGTAGAGGGGGGAAGGGGGCGTCGAAGAGAAGTCAAGCAAGAAATTATGGTCGATAAGGTCATGCATTTCTATTTA
TCGCGAAGATGCGGCGGAGAAAGAGAGAAGACGAGGGTC