Description :
From Genome Similarity Track
Location :
Scaffold_15:1303- 5947
Transcript NameFunction/comments
Physo_131230hypothetical protein
Physo_131231reverse transcriptase

Sequence
4644 bases(100 bases per row)
ATGACCTGTTCGACTTGGACATCAGAGCGCCGAGAACCACGGCCGCCATCTCGACGGCGACAGCCGGCGGCGTAGGCCTTGCCCGCGTACGCTTCTCAGC
AGCGTCTGAGCTGAAAGAGTTCTCAGGACGGGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCGTCTGAAGTCCGCCGCGCGGCGCGCCGGGATG
ACGGGTGAAGAAGTGTGCGGGCAGTTCAGCGATCTGATGAGCGGCCCTGCGCGCCAATGGTACCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCG
AGCTGATGCAGCAATTCCGTGTGCAGTACTGCGGCAAGGGCGTGTCAATGACCAGCCGCTACTACCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGA
TTACTTGTACCGGCTCAACGTCGCGGGCTTGAGGGCCAACATCCCATACGCCGAGGGCACGACTGAAGAGAAGCGCGAACACGTCGAGCATTTCATCCGG
ACGCTGAACACGCAGGAGGCCGAACTCGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGTG
GATTGGCTCACCAGAAAAAGACTCTCTTCGGCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCA
CGTTGCGTCGGACGAGTACGACTCGGAACGCGAGAGTCGCGACAGCGACGATCGCCAGTACGATCAAGACGGGGAGGACGAAGAACGCGCCAATTTGTTC
GTCGCGGGGCAGACCCCGCCGGGAGAGCCGGCGCGTCGCAACTTCGATCCCGACGACTCGGGACGCGACCGCCCGCGGTGCCGCCACTGTGGTTCACGTC
GCCATGCCGAAGGAGACTGCTGGAAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGTGATGCTTGAGGGTGTGCAAGGCCTGCGGTGA
CGTGCACGAAGCCGGAGAATGCTCGATGGAGGAGTTCTTAAACCAATTGCGCCAGTGGTTTCACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCC
GAGAAGATGTTAAACTAGGACGCTCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAAGT
GGTTAGTGAGAGCCCGACTTCCCTGAATGATAATACATGTGAATCCAACCTGGAACGTACCACGCAAGAACGCGCGCCGCGAATGTCGGCGGTCCGACGT
ACGACGGACGACGAGTTTGCACGTGAACCACCCCTGGACGAGATCGACTTGCAACCAGACGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGT
GGTACAAGCAGGCCAAGATTCATGGAAAGCTGAACAACCGCCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGC
TCGTGAGGTAGGCTGCCTGATTGACACGGAGATCACGCAAGAGTGGGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATT
ACCTTGGCTGGGAACTTGGCGTACTACATGCACCTGTGGGTCGGCGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAG
TGCGCATCGACACTGCAGATGGCACGGCGTGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCACGGATGCACCCGGT
CAACGTCAAGACGCCTGTGAGGCTCGAACCAGGAGACACGCATGAAGTCTTGCTGAGGCCGGATCGAAACGCGCCGTTCCTGTGGGTGACACGGGCAGAG
TCGTGGGTGACTACCTTTGTCAAGGGGAGAGTCGGAAAGAAAACGTACCTGCGTGTCACGAACATCGGAGACGCAGCGATAACCCTCGACGCACATGAAA
CGCTTGGGTGGTGGACGCCGTCTGACGGCCAGCCTCGGAACCGTGGATTCGTCCGACTGGGCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACGG
CGCGACGCGCGACGCGGAGGTGAACTGGATCCCAGCCGAGCTCGACGGACCGATGACGGATCGCCCCTCATACCCGACGCCTAAAGCCATCTTGCGCCCG
GATCCGAGACAACTCGGGACGCGACGCGCCGTGACCCCAGTGTTGGTGGCTGTCGCGGAAGCGCCGAAGGGAAGGGGGGTAGACTTGCCACCCGACGACC
ACAAGCCGGATACGGCGAGGAGGCGGTGGAAAGCGAACCCGATATGCCTCCGACTGTGACTGGAAAATACTCGACGAGCCAAACTCGACGGACCAAACCC
CGCCGAGCCGAATTTCGACGAGGCGAAACCTGATGAGCAGGAGGAAGACGACGCGGTCCTCATCCACGAGGGGTCCGACCTCTTTGTAGAGGATCTCGAG
TCTGAGATGGCAGTGCTGCCAGACCTCTCACTGACCGCCGAGGTGAAGATCGAGGACTTGAAGGTCGGCATGCCGACTGGACTCCCGCCCGAGGAAGCCG
CGAGACAAGAAACGCGGCTACTCCAAATCATCTGGAAGCGACGGAAGTGGTTGATCGGCAACGCCTTGCCGCCAGCCGCCCTGGGTGTTGTCTGCGACAT
TGACGTGGGCGACGCAAAACCCGTCGCGCAACGCGTCCGGAAAATCCCGCCGCAGTTTCGAGAGAAGGTCGCTGACTTGATCAAAGGGCTGTTGAGCGCG
AGGATGATCCAGAAGTCGAAGTCGCCGTGGGCATCGCCCATTGTCGTGATCATAAAGAAGAACGCCGTCGATATCCGGCTTTGCATTGACTACAGGCTCA
TCAACGGGCTGACACAGTTGATGATTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCTCCCTCGACATGGT
GAGTGGCTTCTGGGTCGTCCCCATGACAGACCGGGCCCGCCTCATCTCAGCCTTCATCACGCCGATGGGACTGTACGAATGGCTGCGTATGCCGTTCGGC
CTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGTGCTCTACGGGTTCATGAAGCTGTCCCCGGATGGCAGCACTCGGGACGTCTTTGAAG
ACGGCAAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGACGGAGGTCGTACATCGACGACATCCTCATCGGGGGCACGTCGTGGGACGACCTGTGCGA
GAAGGTCGAACGCTTGCTGGATGTCTGCGAACAGTGGCACTTGTCCATCAGTGTCGAGAAGAGCGAGTGGGGCATGTCCAAGGTCGACTACCGGGGCCAC
CGAGTCTCAGGACTCGGTCTCGAGGCGAGGCCGAAGAATCTGGAGTCGCTGACGTCGCTCGAGTTCCCGCGCACGCTCAAGGGCCTGTAATCGTTCTTGG
GTAGCCTCGATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTAGGCAACCGCGCTGTATTCGCTGACGGAGACCGACTTCAACGAGTACGTCACGCG
TCCAGAAGTCCGCGGACATGAGAAGTGGACGCACGCGACGCGCGCCTTCGATGCGCTCAAGGCAAAACTCGCCGGGACCCCAATGTTGAAGCACTTCGAC
GCGAACCGAGAATCCGTCGTGATCGTGTACGCCAGCGACTGGGCCATCTCAGGGGTGCTCACGCAAGTCCACGACGATGTGTACATGCCTGTGAAGTTCA
CCAGCCGTACGCTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCCTGTTGCGCGTCTTAAACGAGTGCTACACGATGCTTGC
AGGGAGACCGGTCCGCGTCTTAACACATCACACGACGCTCGCCTGGTTGGTCCGGTCCAAAGGACTACAGGGGCGGCTGTCACAGTGGGCCGCGATCCTC
TCGCCGTGGAAGTTGGAAATCTACCGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGGCCGCGAGCATTACCCCGCGAGCCTTCGTCGACGCGG
CGCTAGAAGAAATCGCCCTACGGAGACGGGCGTCCAGGATTGTAGTCATTCCAGTCCCCGACGTGGCGCGCGACGAGGTCTTGCACGTCTTGAGCTTTGA
CGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAACTGGGAGATCGTGCGCGCCACGTCGGGATATGCGACG
GACCCTCACGCCAACGAGGCGGAATACCGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAGGAGCTTGACGACGTCACCCGACTCGTCGTATGCGGAGACT
CCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGACTGCAAGTCCCCGGGGTTGAAGCTGCTGGGACAAAAGACGCGAAACGCACTCCAGGCATGGCC
GCGCCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGTTGGACAAGCTCTGCAGCGTCAAGGAGGTCGCAACGCGCACAGT
CCCGAGGAGATTCAAGATCTGAAGACGCTGAATCGCTTGGAAGA