Description :
From Genome Similarity Track
Location :
contig_75:130298- 137212
Transcript NameFunction/comments
g10007.t1hypothetical protein PHYSODRAFT_297076

Sequence
6914 bases(100 bases per row)
ATCCTCTCGGGGCCGGCCGACTACATCGTGCTCACCGCGAGTGACGTTCGGGACAATGCCTCCGGTGCATCTGATCGTCTCCACTGGGCCAAGATTTTTG
GGCTGGAGAGGTTTGCAGGATGTCTGCGGCAGACTGTCTTCGAGCCTGGTGCGATTATTGTCCAAGAGGGCCACCAGCTTAACTCTCTCCATCTCGTTGT
TGAAGGCGAGTGTCGGGCCTCTGTTGGGCGTGACGACTTCAATAGCCCAAGCACCGTTCAGCCAACCGACACCAGCTCAAACAGCACCAAACCACCACTG
ACGACTGCAGAGGCTCAGCTCCGGCACACTCGAAAATTTCGCTGGAGTGACGATTCTCAGTTGCCTGTGGCCTCGCTCGGACCAAAGTCCACGATTGGGG
ATATTTCACTCATGCTAGGAATCCCAGAGCCCACCACCGTTAGGGCTGTCACGACAGTAAACGTCCTCTCGCTTTCCCAGGAAGACTTCGTGCGCGAGAG
CAGTGACCGACATGATCCAGCTATAGCCACTTGCATCGAAAGTAAGCATCGCAAGCCAGCTTTGATACCTGTTGTCTCCGCACGCTAATTGCTGCACTTG
TCTAACGATGCTCAGAATTGCAGAGCACAGCGTACGATACACTGCGATTCGTGCTGGAACGTGTCGAAATTGAGTCCAAGAACGAGCACTGCGACCAGCG
TCTCAAGATCGATTCCTTACGCGAAGCACTGCGCCAGAAACATCCAGGTATCTCCCCCTGGATCATACGCATGTTACTGCTTTGTACTGCGACGTTCACT
GACACACCGATGTGATGCAACGCAGTGATGACGAAAGACAAGCAGTCGACAAGCACTTCTTCGGGTTCTACTGCAAATACGCACAGAGCCTCCAGTACAT
CTTCTCAGCCTGAACAACCAGAAGCCATCAGTGCTGGAGGACAGTGCTCTAGCGTCGTATCTCTGCCATCGGTAGTGCTGAAGCATGCCACAGCCAGTGC
AGTCACGAGAAGGCAACACATCCGTAACCAGCTCGGGACTTCCGTCGCTGCCGTTGCGGGAGAAGACGTAGGTCCACTTGAAAGCTCCACAGGAATGACT
CGGCAGCAACGCAAAGCAGCGCGAGCCTTTGCGAGCCTGCAGTTCCCTGTGGCTGGTAAATGTCTCGGGGACTGCGTGAAGACGCCCAGCAGAGCCTCAG
TTGACGAGTCTCCCGTCACAAGTCCAGACTTGCAAGCCACTCCGCAAACCGAGGACCTGCTGTTTTTGTTCCCCACGATGACTCAGCGCCGACAACTTCA
CGGAAAGTACGTAAACCTTGTCTTTGTCTGCTTCATCGTCACTGATCCAGCTCCATGGTAATGACAGGAATTTACCACTGCTGCCTCGATATCGAGGCTT
CGATGCTGTCCCAACAGAGTAAGCGCTTCAGCTGCTCCATCATCAGATAGTCTCGTACAACCCTGTACCGCACAAGCACGATCGGATCAAACCAACACAA
ATACAATTCGCTCTCCGTTACTGGGCAAGCATACATGAATTACCGAACACAAGTACCAATCTTCGCAGCGGCGTCTCACTCTGCCTTCACCTCCTCAGTC
TCACGATCAATTAGATCTCAGTAGGCCTTCCTTTTGTCATCATTTTTGGTCGGCGGTCGCGAAGTCTGGCCCTCGAATCTTGGCGTCATCAGCAAGGGCA
ACTGAGGAAGTGGCTGCAGCATTGTCACTCGGTCGCTCCGTTTTCACCTTCTCAAACGATGAGGTTTGCTGTTCCATGGGCTTCTCACTAGTCTCTCTCT
CGGACTCCTTCCGCTGCTCCTGCGATGTATCTAGTTTCACCCCTTGCGTGACTGCTTGAGCGTTAGGCTTTGCAATTTCTCCCGTCATGGGGTTATCTTC
CTGTGAAGCTGATGCAAGCGTCTTCAGAGCCGTTAGCGTGGCCTCATCGGTAGATGTCTTGCCCCCCGCTGCATTTACTGTGTCTGTCGTTGTCTTAGCT
TTCTTTGCAGCAACTGATTCATCGGCAGCCGCAGAGGATGAAGACGGCGATGTTTCTGATACCGCGCTGTCATCCTCAGATAAGCCACGAGCACGCTTCT
TCAGCAACGTGGCAGACTCCAAAGCCTTCGTCGCATTGCCCATACGAGCATCATCGGACGAAGCACTGGCACTGTCACTCTGCTCAACGCTTCCAGAGGA
GGCTGGCGTCGCAACCTCCTTTTTCACATCATCGTCTTCCTTTGACTCTCCCATCAGCTCGTCGTCATCGTCATCCATCGAATCGTGCACGGGCGTTTCA
TGCACGGGCGATCCATACACGGGTGTTGCCGACGGCGTGTCTACAGGTGTAGCACTCGGGGACTCATCGTCATCATCGTCGTCGTCTCCATCTTCATCCA
TGGAACCCAGGTACTCAATAGCCAACTCCGGTTCAAAAGCCACTTGCTGGACTCCGGGGCCCTTACGCGTGGCGAGGGCGCCCAAATCTTAAATGGCTCA
GAGAAACCGGACGGAGTGGAGCCACCACGGGCTTCCAGGGGTGTCTTGCGCAGCACACCAGGATTGAACTCGATGCGGAAAGCACCTTCACCTTCGAAGA
TGGACTTCGTCTTATTGAGGTAGGCGGCGGCCTTGGCTTCGGCGCCTGCCGGATCTGCTGAGGGCTTTGGCTCGCCCTGCTGCTCCCCAAACGCCTTGGT
GAGCTCTTGGCATATGTCGTCATTTGCCAAGTGCTGCATCTGTTTCAGCACCTGAGTCACCAGCTTGTCCATCGTGAACAAGAAGTACGACGTAGATCCC
ATGAGACTGCGGCAGGAGTCCTCGTACTTGGAATTATCAACCGAGCCATCGATCAGTGAGTACAGCTTCGAGAGGAAAGCCTGGTAGTCGCCGGTCTTCT
CCTTGGTTGAAGCAGATAGGGAGTGGTGTGCGTGGGCAAGAGCGCGCGCTGCCGGGTTGATTGTACGACGGTTGCGGTTGCGTTTCGCCTTCTCGCACAG
GTCAAAGGCACGCTCAAGACGGTTGTGAAGCATTTGGTACAGACGCAGGAACGCATACGCGTGCTGGTTACCATAGAAGCGAGACTTGTAGTCAGCTTGC
ACCTTAGCAGCATCTTGCTTGCTGTCGAGCGCAGGGAGCCCTGGAGGGAAAGCAGCAGCCTCCTGGATGGTAATGGCACCAGGCTGCAGTATGCCTGGCA
CCCAATGGTAGCCAGGTTAATCGAGAAGTAGCCCTTCGCCTTGTTAAACTGCTCCACGGTACCCTCGCCAAAGTCTGTGCTCGCCTCCGTACCCATCGGC
AAAGTCTTGGCTTTCTCGAGCGTCACAGTAGTGCGCTGAGGCTTGCGCACGAGCCACTCCTCCTCCAAGTGGAAGAACGGGAAGAAGAAAGCCTGCCAAA
CCTTGGAAACTTTTTCTTTGTCGGCCACGCTCAAGTTCTTCTCGGCCGCATACGAAAGTAACCCGAACGCCTCCTTGTGGATCTGTACTGAAGCAAACTT
GTACGCAAAGTGCGGCTTCCATTTAGCTGAAGACGAAGCCTGCGCCGAAATTGCCGCCGCCTTTCCATCTGCCGCAATTGGAGCCTTTGCTGAATGTGCA
AACTGCTCCTTCTTGAGCGCATCAGCAATATCCGATGCCTGAGGAGGAGCCTTAACGCTGGCAACAGCAACAGTAGCTGAGACAGTGGATGGTGCTGCGC
TCGAGTCCGTCTTGGACTCTTCCGCGCGCTTCTCGTCTGCTTCCAGTTCTTCTTCGCCTCGCTGCATCATCATCTTCATACCCGTTTGCTTCTTGTCTTT
CTGCTTGAAGTAGAAGCTCGAGTGGTCCAGCGACTTGTGATAGTTCTTTTCATTGACCTCCTTCCACTGTCGGTTAAGGTCTTCGCGCGCGCGGCGCCAT
TCTTCGTCCTTCTGCTTGAGGCGCTTGAGGATCACGGGAATCGCACCCGCCGGGTACTTACGCAGCAAGTCCAAGATCTGCGCCAGAATCGCCGTAGATG
CGCGTGATAGCATTTAGGTGCGTGACACGGAACGTACCCTTGTCCACAACATAGTTCCACAGCTTGTCATCATCGCCACTCGACTTCTTGCTGTTAAGTA
CCTCAATCTCGTGCGCAAGCGGTTCGAGAATGCTAATGGTGGATGCATTAGCCTCGATCACCATATCGATCTCAAAGCGCTCGTCTTCGCACTTGAACAG
CGCCTCCTCGTACTGGTTCTTGCGCATGCTCTTGAACGAGTAATCTTCACTGCCCGTAGGCACTGATACCCAAGAGTCATTGCACACTCGCTTTTCGAGC
GCTGAGCGGTGAGAGCAAGGCGGAATTGGATAGCTTGCGGGCAGACCACGGTACGATGGGGTAGCGCGGCGGCACTGCGACAGGTCCGTTTCCGCCAGAG
GAATGAATGGCCAGATTTCCTTGGGCGTCTTTTGCACACCATGCGAGCACAGCAGGTGGTCGAATTCTTCCACCAAGTCCGTGTGACGGCCAAAAAGGTT
CCTGATGAGCGATAGCATCTCGTTGCGATCCAGCACTTCCTGGCTGTACAGCTCAAGACACTTCAGGAACTCGCGCCAGTTGTCGCGGGACGGAAGAATC
TTCTTGATCTTCTCAAAAATATTCCACTCCTCCTTGTCGAGCAGCACGTCCGAAATTGCCAGGTACGCACGGCGTTCCTTACCGTCGTACGGACGGCGCT
TGGCGCGCTTGTGGTTGAACTGCGCACGGTTGCGCTCGCGTTCGCGCTCCTTCTCGCGGCGCTCCAGAGCCTTTCCACTCAGGCGTTGGTCATCATCCTT
GTAGCCTCTTCCCTTCTTGCCGTATTTCATATAAGCATCCTCGTCATCTCCCATTAAACGTCCACCCTTCATCGCAGCACTGGACGGCGAGTCACCTCCA
CGGTCATCTCGTCGGTCAGACTGCTGGTAGCCACCTTGGCCAAACTTGCGAGCCTTCAGTGCCATTTGATCCTTGCGCTGCTGAGCCTTCTCGGCAGCAC
GGTTCAGACGCTCCTTCGCTTGCTCCTGGACCGCATCGGGCAAGAAGAAGGTAAACTCACGCAGCAGATCCGGGTGGTCTCGGAAAAGGTGCGAGACTTG
GTCCAGCACCTGGCGGATGGAGCGCTGCTCCTTCTGGTAGGTATGCAGGATGGCCAGGAACTCCTTGTACGTCTCAGGCTCATCAGCAAAGCGTTGCTTG
ATAGTGGTCACGTAGTGGATCGCGTGGTCGAACTCCACGGGGTTCGTCGAGCTCCGTGACCCCCCGTTGCCACCACTTGGCGTCGGTGCCTGCTGCTGCT
GCTTCTTCGGCTTCCCACCAGTCTTCATCTGGGCAGAAGGGGGCAGCTGCTGACGCGACGACGGCGTCGGCTTGTGAAGCTCCGGGTGAATACGGCGGCG
GAGGGATCGTCACCGGCGGTGGGCGGTGGCCCATGTTGGCGTTCGACGACTGCCCCACTCCCGAGTACATAGACTGCTGCACACCTCCACGCCCCGCATC
TGCGACGGGATCACCTCAATAGACGTGTCGGGGCGAATACGATACCCTGGCGGCAAGAACGTGTTAAAGCCCAGGATCAGGTTGGGATAACCGCGGAAGA
GCGTCGACACACGCAGGATGACGCCGGGCGTGTCGATGGCCTGCGCCTTAAAGTCCTTCATGACGTCCAAGAACTGGTTGTAGATGTCAGGCTGGTCTCC
GAACTGCTGCTTCACTTGGTCCAGATACAGCAGCGCGTCCTCCACACGCAGCTCCCGATGGCGCGGGGGCGGACCCGACATGGTCTGCTGCTGCTGGTAG
TAGTCTCCCTCAAGTTGGTCGTTGGGGATGATGCGTCCGTCCAGTCCGTACTGCTGCTGAATCGGCACTTGTTGCGCTGCTGCTGCTGCTGTGGATCCGG
TTGACGACGAGGGGGCGACTGCGGGCGCACACTGTAGCCCTGTGTGGCGGATTGAGCCCCCCGGAGGACGGAGCCATGGACTGCTGCACGCTGCCCATGC
TCTGACTCAAACTGGGCGCCTGCATGCGAACCGAGTGGCCCATCATTCCGGTGGCACTGGAAGGTGGAGCCCCCTGTGAGCCCACGGGTTTCCCCAGCAC
GGAGGGGGGCCGCCCGCACCGGAGGATCCTCCCAAGGTCCCGCGGGGCGGGTGGAGGATGGAGCCCGAGAGCGGATGCGGCGAGCGCGACGAGTTGGGCC
GCCACCGCCCAGTGACCCCTGAAGGGGCGGGGGAGGCAACACAGGCCCTCCCGGGTGCATCATGGAGTGCTGCGGCTGTTGCTGAGGCTGCTGGGAGCCG
CCGTGCAGTGGGTGCAGATGGCCGCCGTGCGTGAGCTGCGCCAGCGACGGCTGTGGGTGGTAGCTGTGCTGCTGCTGCTGCTGGCCCGAGGGAGGGCCAC
CCTTTCCCCCCAAGCCCGAGCTGGAGGCCGAGCTGAGCGACGGAGGCCCGTGGCGGTCCCCCGAAGAGCCCGGATACGATGGATTCATCGCGAGACGCGG
CGAGGGCTTCGCTGGGTTTGGCGCTTGTCGGCTTCGCCGGTTCTTTGGAAATGAGCAAGTGGACGGCCTGCTCAGCGGCGGACCCGTCCACCCATGCAGC
CAATAGCTGTCGGATATTAGTGGAGGCACTCGCTACGTCCTATATGACGTTCACTATTGACTAGATTAACGTATTTAGAAGGAGTATAACGGTACATCAT
AGGATGCCCGTTTCTCCGCCGCGATGTTGAAGCAAGTCGAAGTTAATCATGGAGCAGAGCGCGCGAAGTCCTCGACGCACCAGCGCAAGCGGAAGGAGAA
GGAAAAGGTAGCACATGATGGCGTGATCCGCAAGAAGAGCGTTGTGGCGCCAGGTGAGCAGCGCTGGTTGGTTCATTTTAGTGCTGCTTGCTGTGACTAA
GCGCTCGCACCAAT