Description :
From Genome Similarity Track
Location :
contig_19:130262- 131264
Sequence
1002 bases(100 bases per row)
TCATTGGCGTCCCCAGAGAAAACGAAAAGTTGCAGCACATGAAGTTCTCCGAGGTGAGCACGATATCATTGAGTGCAACTGGTACATGTCGGCACGCGAG
TCGGCGAAGACCTTCTGGTCACTTGTGGCCACAAGTTGTGGCCTCCATGTGCTGCACGTTGTCCTGGCAAAGTTAACTTTTTCCGCAATTCACTCCCGAT
TTCGCATTGGCGCTGCAGGCATCGCGCTCGGAGACCAACACCAATGAATCAACATGCAAATTCGGGTGACTCAGCTTCGCGCGCACCACCTTGCAACAAA
AAGATGACAAACCGCAGAACTGTGGACCTGGCCATCAAAAGCTTTATCAAGAAGCGAAAGTGCACCCCAGGTTTGTCAATAAGACAAAGCCTCCAATGAT
ACCAGGATTCAATAGCTTCTTAGTTAAACATACACAGAGGACCCAGTTAGACTTTGTGGCTCGTCGTCGAAGCCAGAAAAATAGAAATCACCGCGCTGGT
CTGCAGTGCAGCATCGATGTTTTGGTGGCACCGAAGCAGCAAGCCAACGACGGCAACTTTGGTCCGAAATTTTAGCGGCCTCGATCGGACCGGGCTCCTT
CCTTCCGGGGGTAGCTGGCACGTGCGGTGTAGCGCATCTTCAGAGTGTTACGCTGGGGATGTTCGCGCTCGGTTCCTTCTCGATTCCTTTTTGACGGCTC
ACTCGTCACGCGTTCGACGCTGAGCGATGATTCCTTTGGGCCCGTGCAGACCCCTGATGCCGCCGCCCGCTGTCCACAACCAATAGCGAAGCCCCACGGT
AACGCAGCCAAAGCCGGCAGCCGAGGACATTCCTGCAATCGTCGCTGGCATCGTTTACGGCAATGCCAATTTGGCATGGAGAGAAGCGACCGCGCACTGT
CAACAACCACAATGACGACCCAAGTGTGGAGGGAGCCAGGGAGAGCTGTTTTGCCAAGGTATAACCGTACAGGTATGTAGTATAGCGACTCGGGGTCTTG
CT