Description :
From Genome Similarity Track
Location :
Scaffold_72:130260- 134284
Transcript NameFunction/comments
Hyaar_Emoy2807989hypothetical protein
Hyaar_Emoy2807990Pc21g00130 putative
Hyaar_Emoy2807991hypothetical protein

Sequence
4024 bases(100 bases per row)
TTTAAATTTAGGCCAGTGTTATCCGTATCACACCCTTTTGTTATATGTTACCACACCCCTATTTCTGACCAATCAGATGACTCAGATCCAAAACTCATAG
CAAAAACCAACGACGTAACCGTACAAATGACCAAAAATGACCAAAACAAAATTAAAAAATGTAAAGCGAAAAGCAAGAATGCAACAAATGAATAATGATT
AAGGTCCGACATGAACAAAAATAACTTTATGTTGCCTTGGTGCTTAGTGTAACTAGATCTATATCTTCCTCCTCTTCTTCACTACCAGAACCATCTTCTT
CATCAACCAAATCTACTGTGGTAATGGTAGGATCATGCTTAGTGGCCATCCACAAACGAAGGTTTTCTGGACAGATCCGGCCCATGACTGCGCCACAGGA
TACGCGAGTCGACGCCAGTACGCGACCACAGGTGGAGCTGGGAATTTTCACCCGTCTCCAGCGCAACAAATTGATTGCTGTTCTTGAATGCAAAACAAAT
TGGCAGCTTGTCGGCTTCCACTCCACAGGTCAACTGCAAGAAGGTCATACTTGCACCAACGCACGTGAATTAATGGACGGGACATTGGTATATGTTTGCA
ATTACGTCCCCCATCACTGGCATTACCATCCACCAGGGTTTCTCGACCGGAATTCGCGAAAGTTTGCGCAAATCTCTGCATGCAGTTCTCGCCTGATCAA
CGCCCAGTCGGATTCAGACCGTTTAAAGAACCTTGCAATTGCACGTTAGCCGCAGTTGCCATAGCCTTCCACATAGATCTCAAAGCGTACGGTGGACCAA
ACAAATGATGGCACAAAGTCTTGGAGAGTTTTGGTGATGACATTCTACTTTTTTGCCTCTTTGACTCCGGCGTTCTCGGTGCATCTCCTTTTATTATGCG
CGTACGAGCGACATATGCTGCATCTCTTTTTTCCTGGCGGTGGAACCTTTCCATCCACGTACTCGAATGCGGAAGGATCTCTTCGCGTCGTATTGTCTGT
TTTGCGGTTGATGCTGCCTTCGGGACGTCCGCGCGTCCGGATTACTTGCGGGTTCGCCACACATGCCACACCATCTTTCTCTACCATGTCAAGGACCATC
TTCTTGAATATCTGTCGCTGGTGCGGCGCAAGGTTCTGGTGCTTTTCAGAGATATTGGCATATTGGCAAGAACGTCGCCTAGAGATTTGTCGGATGGTAA
TGCATTTGCTATTTTGACGGATGCTTGTTGAAGCACCAGTGCGAGCGGAAATCGTATACCCGTACTTGTTCTTTACTGGCGAGTTTCTGCTTTATTGCAT
GTGCGCATGGTATCCCCATGACCTTGGTAAACGTACCGGTGCAAGGCGGAGCATCTGCAGGCAATGCTTGAGCCAGTTGATATTGTCTGGAAGCTTCTTT
GAGGGCTGGATGCGGTACCTTCTTTGCTACATCAGACCAGAATTTCGGTTGAAGTTTCAACAACACTCGAGCCTTCTGATAAGCAGTGTCGCGGCTGATT
TGGGCTCGTTGCTGAGTATGATGCAGCATCAGCTTCTCATAGACTGTTGATATGTCGCCAGTGGACACCCTTATCCAATCTTTCATTGTCGCGTGACCTC
CCTGAACACGAGACGTAACAACAAGCTTGTAATGTGGAATGTGTTACGTCCACATCTTCACAAATTTCTCTTTGTGCAGTAGTCAAGTTTCTTCGAGGTA
CGAGGTGACTGCCAAGGGTAGGGTTGTCTGCATCGTTTTCCAAAGTTCATCAAACTGCAGTTTTGTGACCGTATTGCATAGGCCTTACCAAGTCCCCATA
AACCCCTCCCAGCTCTCGTTCATCGCAAAGTGCTTTTTCAAATTTGTAAGGACATTCTTATTGATATGCCAGAAACATAACAGATTGTATACCCCAGGAA
AGATATGTCCGATTGCGTTCATAAGTGCGAGCTCCCGACCTGTCACAAACACCATATGGTCTACTTGGATTAGCGATTCTGCGACATCTCTCAGTTGCGT
CATTACCCATCGATAATCTTCTTCCTGTTCGCCGGCCGTGAAGCAGTAAGCAAGCGAGAAAGACTGATTTGTTGCTATTATTCCCAATATATGCAGAAGC
GGCATGCGAAATTTGTTGGTCTTGTATGTTGAATCCAACAGAAGTACATCATTTGCTGAAAACGCTTTTGCAACAGCAAGCGCAGAGTTTGGTACAACAA
AAAGAAGAGAGCCTGCCTGAGGTATCGCGTCGAATTTTGTGGCTGATCTGCTTCTCAACAAGCTTGTAAAGTAAGGCTTCCAGAGGTGGCCGTCCAGCCA
GAGACGCGTACTCTGCCTTCACTTTCAGGTTGTAGATGTCGCGCAGGAGTTTTTTGCACATGGGATCGCTTTGAGGTAAGGTGCTGAGAGTTGCCTTTGG
TGATACGCCAGCTTTTGCCAGATGCAGAAATGTCACCTTTTGTTCCGCGTCGAGCGTTCTTGCTGCCGTATAGGCCGCCATATCTTCCGCCGCGTCATGG
TTATGCCCACCATCCTCAACCGTCAGAGCGAGATTGCCATCAGCTGCATTCCGACGAAGTGTTGCCTGAAATGGACAGTCTGTGCGGGAGGTACTGGTGT
TTCGATGTTGGTGCTCCTTGGATCTATGCACTCCACCATGTACACAGTGAATCACGACGTGCTTGAAAGTGTTGCCCTTTTTGTTTCCCACGGTTCGAGA
ATGTCCTATCTTGATGGCTACTTCTCCGATTTTGCATGGGCTGTGAGCTCCTCCAAGGCTTTCTCAAGTGAGACGAAAGATGATTCGGTGGGTGGCTCTA
AAGGCATAGCTGTGAAAGTCGCGTGGTGTCGCACTGGTCAAGAGGATGGTTAGAAAATAGAAGGTCAGTTTTGGTCGCGGTCACGTTATTTGTTTCTGCT
GTGAGATTTGGATCTGAGTCACCTGATTGGTCAGAAATGGGGGTGTGGTACATATAAAACAAGGGTGTGGTACGGATAACACTGGCCTAATTTTAAAATG
GACATGGCATTTAAAATGAGCCCTGAAATAGGGAGGCAATTTTAATGTTTTTAATTCCCAGCGCACAATCCCCAACCTCATCTCCTTCCTCGATGGCCGG
GCGACCAACCTCGGCGCTTACGCTTCAGTTCCATCGCATGCCAGCGATGGGCAACAGAAAATGCGACCTGGCTGAATGCAAACACTGCGGCGAGACTTTT
GCCTGGGGTACCCAAGGGTTCCATCAGCACGCCACAACGACAACTGCCCCGGGGTACGCCAGACATCGCTTCCTTTCTCGTTGTTATTGTTTGCCGACTT
AATTAACCTATTACCAGTTTTCGAAGGGTTTGGGATTGCTGCGTGCAGGGCGCATATCGCACCAGTATGTGTCGGACGAGGACGACGAGCTGATCGAGGT
CAGACCCAGCAAGCGCCCTGCGCTGTCGTCGAAGACGCGCACGTCGTACACTGCGCTTCGTTGATGTGACTCCATGACTGCCGATGATCAGAAATGAAGC
CGACGAGCTGCTGGCGCGCGCGATGCGTCGCTCAGCGGCATCGTTCTCGCTTTTCAAAAGCAATCACTGGAAGGCGTGGCTGGCCAAGATTCGCCCCTCG
TTCCGCTTCCCTGAACCTGACGCCATCGGCAGGCGACTTCTCAACAACGAGTACATGGTCTTTCAAAAGGAGGCGATCCGGGTGATCGGCACATTCAAAA
ATATTTGCATAACGCTCGATGGCGCGACGAACAAGGCGGGGAAGCAGGTCCTTAACATGATGGCGTGCGGGCATCTCGCTTTTTTTCTTATGTACTTCTC
TAGGAACCTACATCGCGAGACGGCGGCGAACCTGCTCGAGAGGCTGAAGGACGCGCGTCTTCGTCTTCGTGTGTCGGTGGGCATGGATTTCGAGGACGAC
GTCGACGTGCTAGAGTAAGTCGCCATAGACGCCGATGCAGCCCGCAAGGAAGAGCCGATGTGGACTCTTACCACGGATTCGCCTCGTGTCATGAAAAGCT
TGTGCCGGAAGGCTCTCGAGTCCG