Description :
From Genome Similarity Track
Location :
scaffold_640:13025- 17637
Transcript NameFunction/comments
g9642.t1hypothetical protein
g9643.t1 conserved hypothetical protein

Sequence
4612 bases(100 bases per row)
CCCCGCGTCTCTTCGGTAAAATCTTGGATAGTTGCCGCGCCCACCGCGCACTGGTCACTCGCCGACTCTCCGCCATGACGCGGCAGCAATCCACGCGCTC
CCCGTCCTCTTCCCCCTCGGTGATCTCCACGCGTCTGCGCGGCCTGTCGTCGCCTGTTCCGGCAGGTCCGGGCAGCGGCGGCGGGCAGCGGACGCAGAAG
CTGCTGGCGCGGCTGTTCCGGCGCAAGGAGCGGTCTCCGTCGGCCCCGCGGCCGCTGACCGGTCGATCGCTGTACGGAGAGGAGGAAGAGACGAAGACAC
ACGTGGACTCGCCCATGCGCGCGCTGCTGCGGTCGCTCAGTCTGCAGCGCGGCCGCCGGACGGAGGTGGTCCGCACGCCGTCGTCCGAACCCGTACAGGT
GCTGGTCGAGGGCGTGCTGACCGTACTGATGCAGCAGCGCTACTGGCGCTCCAGACCCTGCTACTTTGTGCTGGAACAGACGCTGGCAAGCGGGGCGGGG
GCGCTGGGCACCCACGTCAAGTTCACGTTAAGACAGTTCCAGTTCAAGCCCGAGAATAGGAAGCCCGGCCACCTCGTGGCTATCGTCACGCTGTCGCAGA
ACGACGTCGTGACGGATCTGAGATCCCACCAGCAGGTGAAGCACGTGCTGGAGTTGAAGTTGGCGTCTCCAGATCAACGCACGGAACTCGCAGACGCAGA
AGCAGAAGACAGAGAGGAAGAAAACGGCTCACAGGTCCTTCGACTGGCGGCGGTGGACGAACAGACGCACGCCAAGTGGCTGCACACGTTGAATTCGTGC
ATTAGCAAGTTGATCAGTCAGGCGGAGACCCAGTACCGACTTGGAGACTCGACAGGGTGGAATGCAGTGACGGAACCGGCAAAGATCGTGCCGATGTTTG
GAGATGAAGGCAGGAGAGCTAGTGTGCTGGTGACCAGGGACCGGGACCGGGAACGGGAACGCAATGGTAGTGCTATTAGCTGTACCAGTAGTGAATGCAG
CAACAATAATCTCGACGAGACGGACTTCCCAGCGGAGGAGATTCGAGCAGCGAGAAAAGATTTGGGAGACGAGGACGACGAGGAGTCGAAACCAGCGGCG
CACGACATGCAGACAACAGCACGAGTCGTTCCAGATATCACACAGGAAGAGCTGCCTGCGTCTGCTGACATTGGATACTGCTGCACGCCTGACCATCGAT
CAAGTGAGTCATCGAATTCACGAGGTCGAGACACAGATAACAACGCGGCGGACGCAAAAGAAAGCAGCAACCAGGAGGACAATCAGGGCGATGATTCTGA
AGAGGACTCAGTTGCAGGTGACCTTACTACACAAAGTTCAGCGGCACCGTACAAAAGTGCAGTGTTGGCAGGGAGAGGGGCTTCTGCCTACCAGAACGTG
GGGCTGGACGACGAATACAGCAAAGCCAGCACAAGATCGTCAGTTGCAGCTGGAAATGGACACGGGCTTCTTCCGCGTGCTGCATTTGGCGCCTCTAGCA
GCAGCTCTGGTTTATTCCCGATGATGCGGTCACAGACTCACTCCTTCAACGCAAACGGGCAGGTTTTTACTTTGGATACACGTTACCAGCTAGTTAAACC
AATCGGCAACGGGGCGTATGGTGCCGTGATCGCCGTCAAGGATGTTGTCAACGGGGGTGAGAACTTGGCAGTCAAGAAAATCACGAATATCTTCGAGGAC
CTAGTCGATGCGAAGCGTATTCTGCGTGAAGTTCGGCTTCTGGGCCACTTCAAGCACAAGAACATCACTCGCCTGCTGGATCTGTCGCCACCTCCTTCTC
GAAAGCAGTTTGACGATATGTATATTATCACGGAGCTCATGGAGACTGACCTGCACCAGGTCATTTACTCCATGCAGCCCATGTCGGACGACCACGTCAA
GTACTTCTTGTACCAGATGCTCTGTGCCCTGCACCACATCCACTCGGCTGGTGTTTTGCATCGCGATATGAAGCCCAGCAACATTCTACTGAACGCCAAC
TGCGACCTCAAAGTGTGCGACTTCGGTCTCGCTCGTGGAGGCGTCGGTTTGTCGTCGTGGGCGCAGCATGAACTGCCGCACCCTGGCGAACTCACGGAAT
ACGTTGTCACGCGATGGTATCGAGCGCCGGAAATCATGTTGAATTGCCTACAGTACTCTACAGCTATCGACGTATGGGCTGTGGGCTGCATCTTCGCAGA
AATGCTCTTGCGCGAGCCGCTGTTTCCCGGCAATGACTATTTACACCAACTCAAGCTCATCATCAAGTTCCTGGGCACTCCAAAGCAGGAGGACATCAGC
TTTGTGAAGAACACGAAGGCTCTACGGTTCCTGACAAAGCTGGCGATCTCCAAGCCGAAGAAATGGAGGGATGTTTTCGCTGGGAGTGGCGCTGAAAACG
CCGTGAGCTCGGAAGCGACGGATTTATTGAGCAAAATGCTGATGTTTAACCCGGAGAAGCGCATCTCAGTGGACGCGGCACTACGACACCCGTATTTGGC
GACGTTCTTCGACGAAAACGACCTGGCACTCTCCAAGCCGTTCGACTTTTCGTTCGATCTGGCCGACGATCAGTTGTCCAAGGACGCGCTCATCGACCTG
CTGTGCGAAGACATTGAGCAGTTCCACCCTCCCGTGCCGGGCTCCGTTGCGCCGATTCCATTGAGCACCGCTGCCAGCCGCTTCTTCCGAATGGGGATGA
CCGCCTCCGCAAGTTAACCAGAAAGATATCACAGTAAAATAATAACACTAAGCTGCAACTCCGAAGTTTTTTTGGTGCAGCTATTGCAGCGCCTGTCGTG
TGACAACGCCGCCGAAGGTGGCTCTTCATGGGCACAGGCGCTATCGCCATCGCCAAAATACGTCTCCGTTGTGCAGTTGTGCAACAGATTTGAATTTCGC
GCGTGCTGGACCCACATACGTCGGGTCAGTTTCGACGGGAGTTTCAGTGCTTCGAGCCTCGTTCCAAGCATGCGCAGCCACCTCCAAAGTCTCCATGCCT
GTCGAGGTTCGACCAAAGGCGCGAAGTGCGTGCGCTCTCGTGGAATTCGATCTGTTACACGGCACGCCACTGGATCCTTCGCCATCACTCGACCGCCTAA
AAATTAGTGTTCGAAGCTCATTTGAAGCCGGACGTCATGGGGTCCGAGATCACTTCCCCACTTGCCTTCAACTGCACACATCCACTTCAACAACCTTTCA
GCATGAAGTGCTTCGCTTCAATTCTCACTGCCGTCGCAATGTTCGCAGCTTCAGTGAACGCCAACGGCGTCTGCTACGATCCGGATCACGGATACGCGGC
CGGCGCTATGACCGCTCAAAGCGTCAAGGACGACATCGCGACCATCAGAAGCCACGGGTTCAGCTCCGTCCGCACGTACATCTCCAAATTCGGCAACACC
AACTTTGGTCTGGCCATTGCTGAAGCTGGTTACAACATGACCGTCGCTCTTGGCGTGCCGTACCCCCAGGCCGACTACGTGGAGCAGATGGACGCTGCCC
TCACGGCCGCCAATACCGGTGGTGTGAGCTACATCTTTGTGGGCAACGAGAATCTTGCGGACGCTACCAACGTTCCCCCCGAGATGATCAACACCATCAA
GAGCATCAAGTCGCTTGTCCCCGGTAACGTCAAGGTCGGTACTGTGCAGCGCAACACCGAGGTCATCAACTACGCGGGTATCTACGGCTGGTCGGACCTC
GTTGCAGCTTGCGACGTGCTTGGTGTGAACGTCCACCCGTACTTCACCCCCGGAACGACAGCAGACAAGGCCATCGACGTCGTTAACAACCAGTGGACGA
CCATGAAGGCGAACTTCGGTGACAAACTCATTGTCACGGAGACGGGTTGGCCGTCGGACGGCACGTTGCTGGGTAACACGGGCAGCGTCGACGGCACGAA
GAGGTTCTACAGCGACTACAAGGCGTGGAGCAGCTCCATGCCCGAGTCCTTCTACTTCCAGATCTTTGACACCCCGTACAAGTCCACGCCGGTCGAGAAA
TCCTTCGGGCTCCTCGCATCCGACTCGAAACCTAAGTTTGATCTGTCTCAAGGTGCTGGTACTGTCCACGCTTAACGCCCGGGTTTGTGACGCAATTCCT
TGTGCCAGCTCGACGTTTGTAGAGTACCTTTGAGTCGAGGCCACAATTACAATACCATTCACAATAATACCTACGTGTGCTCAATTGAAGCCGCAACCTT
TAAGAAACTGCTTGATATCGTCGCGAATGGCAAAACCCGAACGCAGGTTGCACTGGATGCTGGTGTCCAAAGACACAATGTGATGGTACCAATACGACGG
GAGGTACAGCACCTCACCAGCAGTTAAAGCCACCTCGGCAGCAGGACAATTACGCGCATCCTCCGGCAACGCACTTGTGTCCGACCAGTTGTACGCTGTG
TGCCTCGCAGACTGCCCAGTTGTTAAAAGTCCTTGACACTTGCAGGCACTGGGCGGTGCAATGACGTATCGCTTGGTTCCTCGAATCATAGAGACATGGT
TCAATCCACCATCGATGTGACCCTCGGCAATGATCCCTTCCATCCCAAGACGGCAGCGCATGCCGCGTTCGTTGGCTACTGTAGCGTCACGAATAAACAA
ATCCCCGAACCG