Description :
From Genome Similarity Track
Location :
contig_19:130244- 133177
Sequence
2933 bases(100 bases per row)
GATGCCAGCAGCGCGCGCGTCGACCTGTGCGTTTGTCCATGTAATGAGGGTTGCACCGAATACCCATCGACTCGGTACACATACGTCCTGGCCATCATTG
GCGTCCCCAGAGAAAACGAAAAAGTTGCAGCACATGAAGTTCTCCGAGGTGAGCACGATATCATTGAGTGCAACTGGTACATGTCGGCACGCGAGTCGGC
GAAGACCTTCTGGTCACTTGTGGCCACAAGTTGTGGCCTCCATGTGCTGCACGTTGTCCTGGCAAAGTTAACTTTTTCCGCAATTCACTCCCGATTTCGC
ATTGGCGCTGCAGGCATCGCGCTCGGAGACCAACACCAATGAATCAACATGCAAATTCGGGTGACTCAGCTTCGCGCGCACCACCTTGCAACAAAAAGAT
GACAAACCGCAGAACTGTGGACCTGGCCATCAACAGCTTTATCAAGAAGCGAAAGTGCACCCCAGGTTTGTCAATAAGACAAAGCCTCCAATGATACCAG
GATTCAATAGCTTCTTAGTTAAACATACACAGAGGACCCAGTTAGACTTTGTGGCTCGTCGTCGAAGCCAGAAAAATAGAAATCACCGCGCTGGTCTGCA
GTGCAGCATCGATGTTTTGGTGGCACCGAAGCAGCAAGCCAACGACGGCAACTTTGGTCCGAAATTTTAGCGGCCTCGATCGGACCGGGCTCCTTCCTTC
CGGGGGTAGCTGGCACGTGCGGTGTAGCGCATCTTCAGAGTGTTACGCTGGGGATGTTCGCGCTCGGTTCCTTCTCGATTCCTTTTTGACGGCTCACTCG
TCACGCGTTCGACGCTGAGCGATGATTCCTTTGGGCCCGTGCAGACCCCTGATGCCGCCGCCCGCTGTCCACAACCAATAGCGAAGCCCCACGGTAACGC
AGCCAAAGCCGGCAGCCGAGGACATTCCTGCAATCGTCGCTGGCATCGTTTACGGCAATGCCAATTTGGCATGGAGAGAAGCGACCGCGCACTGTCAACA
ACCACAATGACGACCCAAGTGTGGAGGGAGCCAGGGAGAGCTGTTTTGCCAAGGTATAACCGTACAGGTATGTAGTATAGCGACTCGGGGTCTTGCTTGA
GCGGTTGTTGTTGACATCTAACAATGGTGCCTCAACCCAGCAAACGCCCCCACTTTGTACTGTAGGTCAAAGACGATTGCAACCTGTACTGGACGTTCGT
TTGCGTAACATCACCAGCGATGGTATGTTTGGCACGCTGATTCTCTCAGAGGCAAGCACATTCTCTCGTTTCTCATCAGAGGCAACAGTTTCGCCTAGAT
CACTCGTTGGCGTACTTACCTGCTACTGCTTTATTCTCACGTAGTCGTTGTCACAGGCCCAAGTCGTTTCCAGCACCCTCAGTGTCTGATGAACTAGATA
CCCACGGGTCGTCCACACTGTACTGACCACAAAAGTTTCATCCCCAGACCGTGAACGAAAACAACTGTACCATTGGCGAGGTACGGTACGGTTGCTAGCC
TCAACAAACAACAGCAGCGTGTCTCGAAGCAAGTGCTTCCCGGCACGGATACCCGTCGCATGCACGGTCGTCTGCACGGTTCACAGCCAGCTCACTGTGA
TTGCCTGGACTCGAGTTTCGAGCCAGCTGCTCACCTCGTGGTTACCTGGAGCATGGAGGATTTCTCTCTCCTCCACGCGAAGAAAGAGCCCTGGCGATCA
CCCCTGATCTTAGCAATGGGCTACACGAAGTGGTGGTTTCTGTGGCTTCTTCTGTGGCTTCTGCTCAGGTTCTTCCAGTCTGCTCCGTTCTAACGCATTC
ATGGCCATGGACAGATAACGGCGAATGATCTCGCCTTGAACAGATAACGACGGATGATATGTATCCTTGAGCAAATTCGGCTTTCCGATCAGTAGTGATT
TGTTATACCTTTTCCATTGTGTGGAAATAGTAGTATGTGGCTGCGCTCAGCACTTACTTATCCGTTAGCTTGATTTGCGGACGCTAAGTCCTCCGAGCCG
GGAGCCCGTGCTGCCGAATCCCAATGCAGGCAAGCCCTCGCTGCTCTGTTTCGGATGTTCTATTGATTCTATTGACAAGGCCAGCCAGCGAGACCTTTGG
CACTCAAAGAGCAATGGAAAGGCCTTGTGTCGACTTTGCCGAAATCGACGGAGGGTCTTGTTTGTGAGGTGTCGGAACTTGCTTGTGGATTATTACGGTT
CTGGAGGTTGTAGTTGGTGTAGTTGATGCGCGGTGTTGAGGGCAAAATACAGAATGGTTATATTTTTTGTTTTGTTTTCGTGCCCTGTTGTTTCTTGCTT
TCCTAGGGCTCCGCTCTAGGAACGACACCTTTCAATACATACACCAAGTCTTGGTTGTCTTCTTCAACCTCTTGATTATGGTCGTGGCGATGCTCGCCGT
TGGCTTGAACGCTGGGTTCGCGTGGGTTGCAGATTTGCAACATGAAGCGCTTTGCTGGCAACCTGATCGTCTGTTGCACGAGCATGGGCTGCGAAAGCTT
TCCTGTTGACGCCACCACCATCAACGAGTGTGTCATGGGTTGTTGCCGGTGCGACTCGACTTGATTGTCCGCGAGTCCGAGCGCTAGCGTGGCTTGCGTT
GCGCGCAGCCAAAGGCTGACAATCTCCCCTAGAAGAATTGCTCTTACTGCGTTGCTGCTCCCGCAGCCCCTTCAGTAATTGATGCCAATGAACGACATGT
TTGATGTCCTTCTCTAATTCCCATGTACACTCTGACATCGGCTCACCAAGCCACTTGACGAGATACTCTGGCTTTCGGTTAAACTGCCTTTTGGCAATGA
GCCGCTCCACAATACGCATACCGTCGTCGACAAGTTCATCGGGCAGTTCTACTGGGGTGTCCTTGAATTTTGGGCGCGAGCGGAACCGTTCGAACTGCTC
TGGGTACGGCGAAAGGAGGTCGACATTGAAGGA