Description :
From Genome Similarity Track
Location :
contig_19:130232- 135327
Sequence
5095 bases(100 bases per row)
CATCGACTCGGTACACATACGTCCTGGCCATCATTGGCGTCCCCAGAGAAAACGAAAAGTTGCAGCACATGAAGTTCTCCGAGGTGAGCACGATATCATT
GAGTGCAACTGGTACATGTCGGCACGCGAGTCGGCGAAGACCTTCTGGTCACTTGTGGCCACAAGTTGTGGCCTCCATGTGCTGCACGTTGTCCTGGCAA
AGTTAACTTTTTCCGCAATTCACTCCCGATTTCGCATTGGCGCTGCAGGCATCGCGCTCGGAGACCAACACCAATGAATCAACATGCAAATTCGGGTGAC
TCAGCTTCGCGCGCACCACCTTGCAACAAAAAGATGACAAACCGCAGAACTGTGGACCTGGCCATCAAAAGCTTTATCAAGAAGCGAAAGTGCACCCCAG
GTTTGTCAATAAGACAAAGCCTCCAATGATACCAGGATTCAATAGCTTCTTAGTTAAACATACACAGAGGACCCAGTTAGACTTTGTGGCTCGTCGTCGA
AGCCAGAAAAATAGAAATCACCGCGCTGGTCTGCAGTGCAGCATCGATGTTTTGGTGGCACCGAAGCAGCAAGCCAACGACGGCAACTTTGGTCCGAAAT
TTTAGCGGCCTCGATCGGACCGGGCTCCTTCCTTCCGGGGGTAGCTGGCACGTGCGGTGTAGCGCATCTTCAGAGTGTTACGCTGGGGATGTTCGCGCTC
GGTTCCTTCTCGATTCCTTTTTGACGGCTCACTCGTCACGCGTTCGACGCTGAGCGATGATTCCTTTGGGCCCGTGCAGACCCCTGATGCCGCCGCCCGC
TGTCCACAACCAATAGCGAAGCCCCACGGTAACGCAGCCAAAGCCGGCAGCCGAGGACATTCCTGCAATCGTCGCTGGCATCGTTTACGGCAATGCCAAT
TTGGCATGGAGAGAAGCGACCGCGCACTGTCAACAACCACAATGACGACCCAAGTGTGGAGGGAGCCAGGGAGAGCTGTTTTGCCAAGGTATAACCGTAC
AGGTATGTAGTATAGCGACTCGGGGTCTTGCTTGAGCGGTTGTTGTTGACATCTAACAATGGTGCCTCAACCCAGCAAACGCCCCCACTTTGTACTGTAG
GTCAAAGACGATTGCAACCTGTACTGGACGTTCGTTTGCGTAACATCACCAGCGATGGTATGTTTGGCACGCTGATTCTCTCAGAGGCAAGCACATTCTC
TCGTTTCTCATCAGAGGCAACAGTTTCGCCTAGATCACTCGTTGGCGTACTTACCTGCTACTGCTTTATTCTCACGTAGTCGTTGTCACAGGCCCAAGTC
GTTTCCAGCACCCTCAGTGTCTGATGAACTAGATACCCACGGGTCGTCCACACTGTACTGACCACAAAAGTTTCATCCCCAGACCGTGAACGAAAACAAC
TGTACCATTGGCGAGGTACGGTACGGTTGCTAGCCTCAACAAACAACAGCAGCGTGTCTCGAAGCAAGTGCTTCCCGGCACGGATACCCGTCGCATGCAC
GGTCGTCTGCACGGTTCACAGCCAGCTCACTGTGATTGCCTGGACTCGAGTTTCGAGCCAGCTGCTCACCTCGTGGTTACCTGGAGCATGGAGGATTTCT
CTCTCCTCCACGCGAAGAAAGAGCCCTGGCGATCACCCCTGATCTTAGCAATGGGCTACACGAAGTGGTGGTTTCTGTGGCTTCTTCTGTGGCTTCTGCT
CAGGTTCTTCCAGTCTGCTCCGTTCTAACGCATTCATGGCCATGGACAGATAACGGCGAATGATCTCGCCTTGAACAGATAACGACGGATGATATGTATC
CTTGAGCAAATTCGGCTTTCCGATCAGTAGTGATTTGTTATACCTTTTCCATTGTGTGGAAATAGTAGTATGTGGCTGCGCTCAGCACTTACTTATCCGT
TAGCTTGATTTGCGGACGCTAAGTCCTCCGAGCCGGGAGCCCGTGCTGCCGAATCCCAATGCAGGCAAGCCCTCGCTGCTCTGTTTCGGATGTTCTATTG
ATTCTATTGACAAGGCCAGCCAGCGAGACCTTTGGCACTCAAAGAGCAATGGAAAGGCCTTGTGTCGACTTTGCCGAAATCGACGGAGGGTCTTGTTTGT
GAGGTGTCGGAACTTGCTTGTGGATTACGGTTCTGGAGGTTGTAGTTGGTGTAGTTGATGCGCGGTGTTGAGGGCAAAATACAGAATGGTTATATTTTTT
GTTTTGTTTTCGTGCCCTGTTGTTTCTTGCTTTCCTAGGGCTCCGCTCTAGGAACGACACCTTTCAATACATACACCAAGTCTTGGTTGTCTTCTTCAAC
CTCTTGATTATGGTCGTGGCGATGCTCGCCGTTGGCTTGAACGCTGGGTTCGCGTGGGTTGCAGATTTGCAACATGAAGCGCTTTGCTGGCAACCTGATC
GTCTGTTGCACGAGCATGGGCTGCGAAAGCTTTCCTGTTGACGCCACCACCATCAACGAGTGTGTCATGGGTTGTTGCCGGTGCGACTCGACTTGATTGT
CCGCGAGTCCGAGCGCTAGCGTGGCTTGCGTTGCGCGCAGCCAAAGGCTGACAATCTCCCCTAGAAGAATTGCTCTTACTGCGTTGCTGCTCCCGCAGCC
CCTTCAGTAATTGATGCCAATGAACGACATGTTTGATGTCCTTCTCTAATTCCCATGTACACTCTGACATCGGCTCACCAAGCCACTTGACGAGATACTC
TGGCTTTCGGTTAAACTGCCTTTTGGCAATGAGCCGCTCCACAATACGCATACCGTCGTCGACAAGTTCATCGGGCAGTTCTACTGGGGTGTCCTTGAAT
TTTGGGCGCGAGCGGAACCGTTTGAACTGCTCTGGGTACGGCGAAAGGAGGTCGACATTGAAGGAAGGATGAATGCGTCGAAATCGCTTTGGTAATTTGA
GCCTAGCCACGTTTTCATTCACCATGTACTCGATGGCAAAAGGTCCCACCAATCGTGCTGCCAACTTTGCTTTAGTTAGCTCCGTGTTCTGAGAAACATG
CTTGAACGATAGATGCTCGGTTTTCAGCAGTACCTGATCACCAGCTTTGAAGTCTGGTTCCGACCGACGCTTGTCGTAATACTGCTTCTGTTTTTGTTTG
GCGTCAAGAAGAGCTTGCTGTGCGCGTTCAACAATCACACGTCGGCGCTCAGCAAACTGCCGAGCAAATTCTGCCTTGGTACGTACTTGGCGAACAGTAT
CATCAGAATTCACAGCTCCGGGGTGCCGTGCAACACGACCACAGTCAATCTCGAATGGTGTCAAACCCGTTGATCTACTCACCAGCGTTGCGTGCGCGAA
TTCAATCGTGCCTAACAATTCTGACCAGTCTGAGCCATGAACACTAGTCATGCAACGAAGGGAGTCTTCCAAAACTCGATTTTGCCTCTCCACTTGACCG
TCCGCTTGTGCACGGTGTGCCGTAGTCATTCGTAATTTTACTCCCATGATCTTCATTAGCTCTTGCCAAAAAGCTGCTGTAAATCAAGAGTCACGGTCGC
TCACAATGACTTGAGGCAAGCCATGGTGGCGTACAACTGACTCAAAGAAGATTCGTGCACAGTCGGCTGCAGTTGCTGTAGAGTGCATGGGTGCATACTT
AGCACGCTTCGAAAGGAGGTCAACTGCAACTTGGATGCAATCAAAACCGTTTGACTCTGGTAGACCAGTGATGTAATCGACGCCCACGTGTTCCCAGCAT
TCCGATGGGATTTCGAGAGGTATCAGCTTCCCTTTCTTCTTGAGGCTCGACACCTTGAATTTGTTGCACGTCAGGCAGCTTCTTACGTAATCGTTGACAT
CAGTCTCCAACTCCTTCCAATAGTACCATTGTTTCACTCGAGCTAGCGTTCGTGGTACGCCTGGGTGTGCTGCACCATCATGGAACTCAGATAAAACTTG
CGTTCGAAGCTCATAGTCATGTGGTACACAGATAGCGTCCACATTACCTTCCATTTGGCGATACACAATGTCATCTTTCCGATAAAACAACCCACCTTCC
ATACTTCGAGGTGCATTGTCTAGAATCGGGCTGAAGTCTGCATCTGTACGATACCCAGCAATGAAGCGCGAGCGCATTTGTCCGGATAGCGCAATCGCTG
TAGCATACCGTGTAGTAGCGTGGACCTGAACCGCAACCTGTTCTTGAGGTACAACAGGACTCCTGCGGTCAACACTCACCCCTCGTGATTGATCATCTAG
GAGAAGATGCAAGTCATACGAGTTGCGAGAGACAAGCGCGTTCATGACCCGTTGGTGATCATCAATTCGTTTTTGGGCATGACTGCATGCCTCAGAACAT
GTGTGTATATCGACAGTGCTCACTTGCACAGCATGATCATCGCTAGTCCCCTGTACTTCATCTTCGACAGGTTCATCACTAATCTGCTCGTCCAATTTTG
CCTGCATGTCTTCAGGGTCACCTGGAAGGTGGCGCGACAAAGCATCGGCAACGATATTTTGAACACCTTTCACATGATGGAGTTGAAAATCGAACTGTGC
GAAAAAGTCGAGCCACCGTGCCAATTTAGATGACACTGTCGGGTGGTTCAGGAACCATCGGCATGCAATATTGTCTGTATACACGTGAAAATGACGCCCA
TGCAAATAGTGGCGCCACTTGCCAAGTGCAAGTTTTATCGCGAACAGTTCTTTTTCGTGAGCTGGCCAATTCAACTCGTGATTGCCCAATTTCTTGGAGT
AGAAGGCGACAGGGTGGTCAAAACCGTCGTGCCGCTGAGATAGAACGCCCCCACAGCACTGCTTAGACGCATCGGTTGTCACAACGAACATCACGTTGAA
ATCCGGCAAGCGGAGAATCGGAGCTTGCTGTAGTGCTGCCTTAATTACCAAGAAGGCATTTTCTTGATACGGAGTCCACTGCCACGTTTTGTCTTTCTTA
ACGAGATTGCTCAGTTGTAAAACGATGTCAGCAAACCGATGAATGAAGCGTCGGTAATAGCCAGCAAGTCCAAGAAAACTCTGCAGTTCCTTTACCGTAG
TTGGCGTTTTCCACTGCTCGATAGCTGCAGTCTTCAGCTTATCGACCTCCAACCCTGCACTTGAGATTGTGTGTCCCAAAAAGTTGACGGATGTC